The largest database of trusted experimental protocols

Universal sybr green fast qpcr

Manufactured by ABclonal
Sourced in United States

The 2X Universal SYBR Green Fast qPCR is a ready-to-use master mix designed for fast and efficient real-time quantitative PCR (qPCR) analysis. It contains SYBR Green I dye, which binds to double-stranded DNA, enabling the detection and quantification of target DNA sequences.

Automatically generated - may contain errors

2 protocols using universal sybr green fast qpcr

1

Quantitative RT-PCR Analysis of Yeast Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Yeast strains were grown to an OD of approximately 0.6 to 1 for collection. Three biological replicates were used for each set of experiments (except 2 replicates for RNH1 levels, S1B Fig). Cells were treated with 50 to 100 U of zymolyase in a 1 M sorbitol/100 mM EDTA solution. Cells were lysed and RNA was extracted using the RNeasy kit and RNase-free DNase set (QIAGEN). cDNA was prepared using the Superscript First Strand Synthesis kit (Life Technologies); oligo d(T) primers or locus specific primers (see Table P in S1 Tables) were used for priming during reverse transcription. RT-PCR samples were analyzed using qPCR (performed in technical duplicate with the average shown) with SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara Bio), Power SYBR Green PCR Master Mix (Applied Biosystems), or 2X Universal SYBR Green Fast qPCR (ABclonal) on a QuantStudio 6 real-time PCR system (Applied Biosystems).
+ Open protocol
+ Expand
2

Quantifying Autophagy Regulators in HEK 293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from HEK 293 cells using a Quick-RNA MiniPrep Kit (Zymo Research, R1055, Irvine, CA, USA). cDNA was synthesized using LunaScript RT SuperMix (NEB, E3010, Ipswich, MA, USA), followed by qPCR using 2x Universal SYBR Green Fast qPCR (Abclonal, RK21203, Woburn, MA, USA). The following primers were used: SETD2-forward CTCCTCCCAAACCAAAAACC, SETD2-reverse GAGTTCCCAGGTCCATCTCA; LC3B-forward GAGAAGCAGCTTCCTGTTCTGG, LC3B-reverse GTGTCCGTTCACCAACAGGAAG; FIP200-forward CAGCACAAAGTTTGGATGAAATGTC, FIP200-reverse CCTGCTGTACTTTCCATCCTTGG; ULK1-forward GCAAGGACTCTTCCTGTGACAC, ULK1-reverse CCACTGCACATCAGGCTGTCTG; ATG13-forward CAGAACTGCTGGTGAGGACACT, ATG13-reverse AGCAGGCTGATAGGAAAGGCGA; GAPDH-forward GAGTCAACGGATTTGGTCGT, GAPDH-reverse TTGATTTTGGAGGGATCTCG.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!