Log In Sign up
The largest database of trusted experimental protocols

Hbvps

Manufactured by ScienCell
Visit Supplier
Sourced in United States

HBVPs are a type of cell culture product offered by ScienCell. They are primary human brain vascular pericytes, which are cells that provide structural and functional support to the blood vessels in the brain. HBVPs can be used for in vitro research and experimentation.

Automatically generated - may contain errors

Lab products found in correlation

Huvecs, by Lonza (5 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions) Pericyte media, by ScienCell (2 mentions) Hmec 1, by ScienCell (2 mentions) Pericyte medium, by ScienCell (2 mentions) Matrigel, by BD (1 mentions) Hbmec, by ScienCell (1 mentions) Endothelial cell medium (ecm), by ScienCell (1 mentions) Streptomycin, by Merck Group (1 mentions) Penicillin, by Merck Group (1 mentions) Egm 2, by Lonza (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Hbvps, by Thermo Fisher Scientific (1 mentions) Nci h460, by American Type Culture Collection (1 mentions) Nci h1299, by American Type Culture Collection (1 mentions) Nci h1703, by American Type Culture Collection (1 mentions) Huvecs, by ScienCell (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Dmem low glucose, by Merck Group (1 mentions)

18 protocols using hbvps

1

Vascular Network Formation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human brain vascular pericytes (HBVPs, ScienCell Research Laboratories; Catalog #1200; isolated from human embryonic brain tissue) served as a positive control of hPSC-CNC PCs in functional assays in this study. HBVPs were isolated from the human brain and cryopreserved at passage one after purification, according to the manufacturer’s instructions. Human brain microvascular endothelial cells (HBMECs, 3 × 104 cells/well) (ScienCell Research Laboratories) were co-seeded with CNC-derived pericyte-like cells (hPSC-CNC PCs) expressing DsRed-Express2 (DsRedE2; 1.5 × 104 cells/well) or DsRedE2-HBVPs on pre-solidified Matrigel (BD Bioscience) in Endothelial Cell Medium (ScienCell Research Laboratories) containing 20 ng/ml vascular endothelial growth factor (VEGF). The cells were incubated for different time periods at 37 °C and 5% CO2 in a humidified atmosphere. The vascular network was photographed at the indicated time points using a BioTek Lionheart FX Automated Live Cell Imager (BioTek Instruments, Inc., Winooski, VT, USA).
Sun J., Huang Y., Gong J., Wang J., Fan Y., Cai J., Wang Y., Qiu Y., Wei Y., Xiong C., Chen J., Wang B., Ma Y., Huang L., Chen X., Zheng S., Huang W., Ke Q., Wang T., Li X., Zhang W., Xiang A.P, & Li W. (2020). Transplantation of hPSC-derived pericyte-like cells promotes functional recovery in ischemic stroke mice. Nature Communications, 11, 5196.
+ Open protocol
+ Expand
2

Culturing Human Brain Vascular Pericytes and Cerebral Endothelial Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
HBVPs: Human Brain Vascular Pericytes (HBVPs, ScienCell, Carlsbad, CA, USA) between the 4th and 10th passage were cultured as described previously [38 (link)]. Briefly, HBVPs were grown in flasks coated with Poly-L-Lysine (PLL; 2 µg/cm2) under standard tissue culture conditions (37 °C, 5% CO2) in pericyte growing media (DMEM/F12 supplemented with antibiotic-antimycotic (AA; 100 μg/mL streptomycin, 100 μg/mL penicillin and 0.025 μg/mL amphotericin B), Glutamax (1×) and 10% FBS). The cells were cultured until sub-confluency and media was changed every two or three days.
hCMEC/D3: The human Cerebral Microvascular Endothelial Cell line (hCMEC/D3) [39 (link)] was kindly provided by Dr. Pierre-Olivier Couraud (Institute COCHIN, Paris, France). Cells between the 34th and 39th passage were cultured as described before [38 (link)] on rat-tail-collagen-coated (250 μg/mL in 80% EtOH) flasks under standard tissue culture conditions (37 °C, 5% CO2) in complete growing media (EC basal media (EndoGRO Basal Medium supplemented with 0.2% EndoGRO-LS Supplement, 5 ng/mL rh EGF, 4 mM L-Glutamine, 0.75 U/mL Heparin Sulfate, 50 μg/mL Ascorbic Acid, 1 ng/mL bFGF, antibiotic-antimycotic (100 μg/mL streptomycin, 100 μg/mL penicillin and 0.025 μg/mL amphotericin B) supplemented with 5% FBS. Media was changed every two or three days and cells were passaged after confluency was reached.
Kurmann L., Okoniewski M, & Dubey R.K. (2021). Estradiol Inhibits Human Brain Vascular Pericyte Migration Activity: A Functional and Transcriptomic Analysis. Cells, 10(9), 2314.
+ Open protocol
+ Expand
3

Endothelial and Pericyte Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs (pooled
donors; Lonza, Walkersville,
MD) were used at passage three and cultured in endothelial growth
medium (EGM-2, Lonza) supplemented with 2 mM l-glutamine,
1000 U/mL penicillin, and 0.1 mg/mL streptomycin (Sigma; St. Louis,
MO). HBVPs (ScienCell, San Diego, CA) were cultured in Pericyte Media
(ScienCell) in poly-l-lysine (2 μg/cm2)
coated tissue culture plastic flasks and used at passage three. All
cell lines were maintained at 37 °C with 5% CO2.
Schweller R.M, & West J.L. (2015). Encoding Hydrogel Mechanics via Network Cross-Linking Structure. ACS Biomaterials Science & Engineering, 1(5), 335-344.
+ Open protocol
+ Expand
4

Human Brain Vascular Pericyte Modeling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human brain vascular pericytes (HBVPs) were purchased from ScienCell (#1200) and maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin at 37°C in 5% CO2‐humidified incubator. After reaching 80%‐90% confluence, the cells were passaged with trypsin (0.25%)‐EDTA (0.02%) in PBS at a split ratio of 1:5. The media were changed every 2 days.29When reaching 60%‐70% confluence, the HBVPs were transfected with 10 μM Senp1 siRNA using Lipofectamine® RNAiMAX Reagent (13778, Invitrogen) for 48 h as described in the manual guide. Then, the cells were cultured with glucose‐free Hanks' Balanced Salt Solution (HBSS: 116 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 1.0 mM NaH2PO4, 1.8 mM CaCl2, and 26 mM NaHCO3, pH 7.3) for another 6 h. Thereafter, the cells were captured or used for Western blotting assay and immunofluorescence assay.
Sun M., Chen X., Yin Y., Gao Y., Zhang L., Chen B., Ji Y., Fukunaga K., Han F, & Lu Y. (2020). Role of pericyte‐derived SENP1 in neuronal injury after brain ischemia. CNS Neuroscience & Therapeutics, 26(8), 815-828.
+ Open protocol
+ Expand
5

Culturing Diverse Cell Types for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human umbilical vein endothelial cells (HUVECs), human microvascular endothelial cell line-1 (HMEC-1) cells and human brain vascular pericytes (HBVPs) were provided by ScienCell Research Laboratories (Carlsbad, CA). The human NSCLC lines NCI-H1299, NCI-H1703, NCI-H460 and A549 cells were provided by American Type Culture Collection (ATCC, Manassas, Virginia). HUVECs were cultured with ECM. HBVPs were maintained in PM. HMEC-1 cells were cultured with DMEM supplemented with 10% FBS. The human NSCLC cell lines were cultured in RPMI 1640 medium containing 10% FBS and 1% penicillin–streptomycin (v/v). All the cells were maintained in a humidified incubator containing 5% CO2.
Lei X., Li Z., Huang M., Huang L., Huang Y., Lv S., Zhang W., Chen Z., Ke Y., Li S., Chen J., Yang X., Deng Q., Liu J, & Yu X. (2024). Gli1-mediated tumor cell-derived bFGF promotes tumor angiogenesis and pericyte coverage in non-small cell lung cancer. Journal of Experimental & Clinical Cancer Research : CR, 43, 83.
+ Open protocol
+ Expand
6

Müller Cell Line MIO-M1 Knockdown Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human Müller cell line MIO‐M1 was a gift from Prof. S. Yoshida (University of Kurume, Kurume, Fukuoka, Japan), and was cultured in DMEM‐low glucose (Sigma) supplemented with 10% FBS (Gibco; Waltham, MA, USA) and 1% penicillin‐streptomycin (Gibco). GFP‐expressing HUVECs (Angio‐Proteomie; Boston, MA, USA) were cultured in EGM medium (Lonza; Basel, Switzerland). HBVPs (Sciencell; Carlsbad, CA, USA) were cultured in pericyte media (Sciencell). All cell lines were cultured as recommended by the manufacturer and incubated at 37 °C with 5% CO2. For knockdown experiments, siRNAs were transfected using G‐fectin (Genolution; Seoul, Republic of Korea) as instructed by the supplier. siRNAs targeting TRAP1, HIF1α, calpain‐1, calpain‐2, and CypD were synthesized by Genolution as follows:
SpeciesNameSequence (5′→3′)
MousesiTRAP1‐#1AAACATGAGTTCCAGGCAGAG
MousesiTRAP1‐#2GCCCGTTCTCTGTACTCAGAA
MousesiHIF1α‐#1GGGTTATGAGCCGGAAGAACT
MousesiHIF1α‐#2GATGGAAGCACTAGACAAAGT
HumansiTRAP1‐#1AAACATGAGTTCCAGGCCGAG
HumansiTRAP1‐#2CCCGGTCCCTGTACTCAGAAA
HumansiCalpain‐1GGAACAACGTGGACCCATA
HumansiCalpain‐2CTATTGGCTTCGCGGTCTA
HumansiCypD‐#1GGACTCTAATACCTGTTTA
HumansiCypD‐#2GGCAGATGTCGTCCCAAAG
HumansiANG2GTGACTGCCACGGTGAATAAT
HumansiHIF1αGGCCACATTCACGTATATGAT
John Wiley & Sons, Ltd.
Kim S., Yoon N.G., Im J.Y., Lee J.H., Kim J., Jeon Y., Choi Y.J., Lee J., Uemura A., Park D.H, & Kang B.H. (2023). Targeting the Mitochondrial Chaperone TRAP1 Alleviates Vascular Pathologies in Ischemic Retinopathy. Advanced Science, 11(2), 2302776.
+ Open protocol
+ Expand
7

Nitrosative Stress Response in HBVPs and HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human brain vascular pericytes (HBVPs) were purchased from ScienCell (#1200), and human embryonic kidney 293 (HEK293) cells were purchased from the American Type Culture Collection (ATCC; Cat# CRL-1573). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin, and cultured at 37 °C in 5% CO2. For nitrosative stress studies, cells were treated with 0.5 mM 3-morpholino-sydnonimine hydrochloride (SIN-1, M5793, Sigma-Aldrich) for 12 h.
Chen D.Y., Sun N.H., Lu Y.P., Hong L.J., Cui T.T., Wang C.K., Chen X.H., Wang S.S., Feng L.L., Shi W.X., Fukunaga K., Chen Z., Lu Y.M, & Han F. (2019). GPR124 facilitates pericyte polarization and migration by regulating the formation of filopodia during ischemic injury. Theranostics, 9(20), 5937-5955.
+ Open protocol
+ Expand
8

Isolation and Characterization of HUVEC and HBVP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary human umbilical vein endothelial cells (HUVECs) were either purchased from Lonza (Walkersville, MD) or isolated from a single umbilical cord by a method described previously
[23 (link)] and maintained in endothelial cell growth medium EGM-2 supplemented with EGM-2 SingleQuots except for hydrocortisone (Lonza,). Human brain vascular pericytes (HBVPs) were obtained from ScienCell Research Laboratories (Carlsbad, CA), and were grown in Pericyte Medium (ScienCell). To confirm their authenticity, cultured HBVPs were examined for expression levels of 6 key pericyte markers grown on plastic (Additional file
1). Both HUVECs and HBVPs were grown on collagen type I-coated plastic ware. For cell proliferation and gene expression experiments, cells were used at <5 passages.
Green fluorescent protein (AcGFP)-expressing HUVECs were established by infection with a retrovirus for gene transfer of AcGFP followed by collecting high level AcGFP-expressing HUVECs by fluorescence activated cell sorting. Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2.
Paclitaxel was purchased from Sigma-Aldrich (Saint Louis, MO) and Wako Pure Chemical (Osaka, Japan). Eribulin mesylate was manufactured by Eisai Co., Ltd (Ibaraki, Japan). Both compounds were dissolved in DMSO to yield a stock concentration of 1 mmol/L.
Agoulnik S.I., Kawano S., Taylor N., Oestreicher J., Matsui J., Chow J., Oda Y, & Funahashi Y. (2014). Eribulin mesylate exerts specific gene expression changes in pericytes and shortens pericyte-driven capillary network in vitro. Vascular Cell, 6, 3.
+ Open protocol
+ Expand
9

Characterization of Endothelial and Pericyte Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human umbilical vein endothelial cells (HUVEC), Human microvascular endothelial cell line (HMEC-1), and Human brain vascular pericytes (HBVPs) were obtained from ScienCell Research Laboratories. HUVECs and HMEC-1 cells were cultured in ECM, and HBVPs were cultured in PM. The human non-small lung cancer cell line NCI-H1299 cells (it is isolated from a NSCLC patient with lymph node metastasis who have received prior radiation therapy and has a homozygous partial deletion of the p53 protein) were purchased from American Type Culture Collection (ATCC, Manassas, Virginia) and cultured with DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. All these cells were maintained in humidified atmosphere containing 5% CO2 at 37 °C. We showed that all these cells have no cross contamination of other human cell lines using the STR Multi-Amplification Kit (Microreader 21 ID System).
Lei X., Zhong Y., Huang L., Li S., Fu J., Zhang L., Zhang Y., Deng Q, & Yu X. (2020). Identification of a novel tumor angiogenesis inhibitor targeting Shh/Gli1 signaling pathway in Non-small cell lung cancer. Cell Death & Disease, 11(4), 232.
+ Open protocol
+ Expand
10

Cell Lines and Culture Conditions

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-10A and MCF-10AT cell lines were provided by J. Liu (University of California San Francisco). Finite lifespan HMECs and fibroblasts were provided by J. Garbe. HUVECs, MSCs, and SMCs were purchased from Lonza. HBVPs were purchased from Sciencell. CAD cells were provided by K. Monahan (University of California San Francisco). Bone marrow dendritic cells were provided by B. Boldajipour. Jurkats were provided by Z. Gartner.
MCF-10A and MCF-10AT cell lines were cultured as previously described23 (link),36 (link). Primary human mammary epithelial cells at passage 4 were established and maintained in M87A medium according as previously described37 . CAD neuronal cells were cultured as previously described38 (link). All other cells were cultured according to standard practices listed on American Type Culture Collection or Lonza.
No mycoplasma testing or cell authentication was performed for the experiments in this study.
Todhunter M.E., Jee N.Y., Hughes A.J., Coyle M.C., Cerchiari A., Farlow J., Garbe J.C., LaBarge M.A., Desai T.A, & Gartner Z.J. (2015). Programmed synthesis of 3D tissues. Nature methods, 12(10), 975-981.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!