For the chemically modified gRNAs, including 5′ end 2′-O-methyl 3′ phosphorothioate (MS) modified and/or cyanine 3 (Cy3) labeled, and 3′ end Cy3 labeled gRNAs for dPspCas13b targeting, as well as the 3′ end MS-modified gRNAs for dRfxCas13d targeting, were synthesized at GenScript Company.
For gRNAs produced by IVT, the DNA templates for gRNAs were amplified by primers, followed by agarose gel purification. The gRNA sequences containing the T7 promoter (GAAATTAATACGACTCACTATA) are listed in Additional file2 : Table S1. The IVTs were done with T7 polymerase (Promega, Cat. No. P1300) to produce gRNAs. After that, the gRNAs were purified from denatured PAGE gel.
For mRNAs produced by IVT, DNA templates were digested from constructed pCS2-coding sequence plasmids with NEB restriction endonuclease, either NotI or KpnI, respectively, followed by purification with StarPrep Gel Extraction Kit StarPrep (GenStar, Cat. No. D205-04). mRNAs were then transcribed and purified in vitro by mMESSAGE mMACHINE™ SP6 kit (Thermo Scientific, Cat. No. AM1340) according to the manufacturer’s protocol.
For gRNAs produced by IVT, the DNA templates for gRNAs were amplified by primers, followed by agarose gel purification. The gRNA sequences containing the T7 promoter (GAAATTAATACGACTCACTATA) are listed in Additional file
For mRNAs produced by IVT, DNA templates were digested from constructed pCS2-coding sequence plasmids with NEB restriction endonuclease, either NotI or KpnI, respectively, followed by purification with StarPrep Gel Extraction Kit StarPrep (GenStar, Cat. No. D205-04). mRNAs were then transcribed and purified in vitro by mMESSAGE mMACHINE™ SP6 kit (Thermo Scientific, Cat. No. AM1340) according to the manufacturer’s protocol.