Hieff trans

Manufactured by Yeasen

Sourced in China

The Hieff Trans is a laboratory equipment product designed for high-efficiency molecular transfer. It functions as a tool for introducing genetic material or other substances into cells or organisms.

Automatically generated - may contain errors

Lab products found in correlation

Facsaria 1, by BD (1 mentions) Hek293t cells, by Thermo Fisher Scientific (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Vigofect reagent, by Vigorous Biotechnology (1 mentions) Opti mem, by Thermo Fisher Scientific (1 mentions)

4 protocols using hieff trans

Lentiviral Transduction and Cell Line Engineering

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells (derived from Cell Bank of Chinese Academy of Science) and HEK293T cells (derived from Invitrogen) were grown in high glucose DMEM (Hyclone) with 10% FBS (Gibco). All cell lines were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO₂. All cell lines were tested for mycoplasma contamination and experiments were conducted under mycoplasma- negative conditions.
For transient transfection, approximately 60,000 or 20,000 HeLa cells were plated on a 4-well glass bottomed dish (35 mm²) or 96-well plate per well (WHB), respectively. The plasmids were transfected with lipofectamine 2000 (Invitrogen) or Hieff Trans (YEASEN, China) according to the manufacturer’s protocol.
The pLVX lentiviral plasmids encoding sensors (iNap, roGFP1, FLII^{12 (link)}Pglu700µ), NADK were constructed. Lentivirus was produced by co-transfecting two lentiviral packaging vectors (pMD2G and psPAX2) in HEK293T cells. Lentiviral supernatants were collected 48 and 72 hr after transfection. HeLa cells in 6-well tissue culture plates were infected in media containing 4 µg/ml polybrene and centrifuged at 1,800 rpm for 1 hr. Post-infection, virus was removed and cells were selected with 0.2–1 µg/ml puromycin for 1 week. After 1 week, the stable cells were selected by FACS Aria I (BD).

Tao R., Zhao Y., Chu H., Wang A., Zhu J., Chen X., Zou Y., Shi M., Liu R., Su N., Du J., Zhou H.M., Zhu L., Qian X., Liu H., Loscalzo J, & Yang Y. (2017). Genetically encoded fluorescent sensors reveal dynamic regulation of NADPH metabolism. Nature methods, 14(7), 720-728.

+ Open protocol

+ Expand

Assessing PID1 Expression and Raf-1 Silencing in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human expression plasmids (FLAG-tagged PID1, HA-tagged Raf-1, His-tagged BAD and HA-tagged PDPK1 mutant) and mice PID1 expression plasmid were obtained from Gene Create (Wuhan, China). The cancer cell lines were transiently transfected with empty vector or PID1 expression plasmid using Neofect^TM (Neofect Biotech, Beijing, China). The transfected cells were assessed for PID1 expression by western blot analysis. Specific siRNA targeting Raf-1 (Raf-1 si#1: 5’-AAACUCAUCGCUCAUCCUUCG-3’; Raf-1 si#2: 5’-AUCUGUAGCACUAGCGUCUUC-3’; Raf-1 si#3: 5’-UUUGCCCAAGUUUCGAUCCCA-3’) were obtained from Gene Create. The cells were transfected with Raf-1 siRNA using Hieff Trans (YEASON, Shanghai, China). The silencing efficacy of the respective siRNAs was confirmed by western blot analysis. For lentiviral infection, Hep3B cells were incubated with lentivirus-CRISPR/Cas9-puro-PID1 KO construct (sgRNA1#1: GGCAGTCCATCTGGTAGGAC; sgRN1#2: TCATCTCGACCACAAAGGGG; sgRNA#3: AGATGTTGGGGCTCACGTTG) at MIO of 20 for 24 h, and then treated with 2 μg/mL puromycin for 72 h.

Yang J., Li S., He J., Xu Q., Xie M., Yang C., Wang H., Zhang Y., Wan Q, & Xiang M. (2023). Dual role of PID1 in regulating apoptosis induced by distinct anticancer-agents through AKT/Raf-1-dependent pathway in hepatocellular carcinoma. Cell Death Discovery, 9, 139.

+ Open protocol

+ Expand

Transient and Lentiviral Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For transient transfection, cells were plated 12–24 h prior to transfection to achieve 50–70% confluency and then transfected with Hieff Trans (Yeasen, Shanghai, China) or Vigofect reagent (Vigorous Biotechnology, Beijing, China) according to the manufacturer’s protocol. Cells were collected 48 h after transfection.
For generating lentivirus, HEK 293T cells were transfected with pLL-3.7-lnc-RPS6P3 or pSIH-lnc-RPS6P3-shRNA and the packaging plasmids (pLP1, pLP2, and pLP/VSVG) for 48 h. Then the supernatant was collected, followed by filtration with 0.45-μm sterile filters (Merck Millipore, Burlington, MA, USA). For generating stable cell lines, A549 cells were infected with indicated lentiviruses for 12 h. The GFP positive cells were selected by flow cytometry.

Wang M., Yao X., Tong X., Qi D, & Ye X. (2024). Lnc-RPS6P3 Inhibits Influenza A Virus Replication and Attenuates the Inhibitory Effect of NS1 on Innate Immune Response. Microorganisms, 12(4), 654.

+ Open protocol

+ Expand

MALAT1 Silencing via siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small-interfering (si)RNA targeting the long noncoding RNA (lncRNA) MALAT1 and si-NControl (5′-GCUCCGAUUUCUCGAACAA-3′ and 5′-GAGUUGUGCUGCUAUCUUA-3′, respectively) were synthesized by Genomeditech (Shanghai, China). The microRNA (miR)-92a-3p inhibitor was obtained from RIBOBIO (Guangzhou, China). Cells (1.5 × 10⁵ cells/mL) were cultured in six-well plates, and fusion was observed at ∼50% confluence after 24 h. The supernatant was then discarded, and 2 ml of DMEM was added. We then dissolved 2 µL of siRNA/miRNA or si-NControl in 200 µL of Opti-MEM (Gibco), followed by the addition of Hieff Trans (6 µL) in vitro siRNA/miRNA transfection reagent (YEASEN) was added and incubated for 10 min. The siRNA mixture was then added dropwise to each well and incubated for 48 h for subsequent experiments.

Zhang Y., Hu R., Xi B., Nie D., Xu H, & Liu A. (2022). Mechanisms of Senescence-Related NKG2D Ligands Release and Immune Escape Induced by Chemotherapy in Neuroblastoma Cells. Frontiers in Cell and Developmental Biology, 10, 829404.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!