Primescript 2 rt kit

Total RNAs were extracted using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and reverse transcribed using a PrimeScript II RT kit (Takara Bio, Otsu, Japan) to obtain cDNA samples. qPCR analysis was performed by using SYBR Premix EX Taq II (Takara Bio, Otsu, Japan) and a CFX96 thermal cycler (Bio-Rad, Hercules, CA, USA) as previously described [19 (link)]. The sequence of primers used is listed in Supplementary Table S2.

Total RNA was extracted from mock and HHV-6A-infected HSB-2 cells using TRIzol reagent (Invitrogen, USA), cDNA was generated using a PrimeScript II RT kit (Takara) according to manufacturer’s instructions. Quantitative RT-PCR was performed on a 7500 fast PCR System (Applied Biosystems) using the TB Green Premix Ex Taq (Takara). Data were normalized to the expression of β-actin. Additionally, viral DNA was extracted from HHV-6A-infected T cells and supernatants, respectively, and viral DNA was quantified using the U22 primer set. Quantitative PCR primer pairs are listed in S1 and S2 Tables.

Total RNAs were isolated using TRIzol reagent (Life Technologies) according to the manufacturer’s instruction. A PrimeScript II RT Kit (Takara Bio, Otsu, Japan) was used to synthesize cDNA. SYBR Premix EX Taq II (Takara Bio) and a CFX96 thermal cycler (Bio‐Rad, Hercules, CA, USA) were used for qPCR. The following primer pairs were used for the experiments: JDP2 total, 5'‐ GAGGTGAAACTGGGCAAGAG‐3', and 5'‐ GCTGCTGCGACTTTGTTCTT‐3'; JDP2 variant 2, 5'‐GGG AGG TTA AGG CTG GCC TG‐3' and 5'‐ AGC GTA TTT CAG CTC CA‐3'; JDP2 variant 3, 5'‐CCT TCT GCA CGG CTG GCC T‐3' and 3' primer of variant 2; DR5, 5'‐ATC GTG AGT ATC TTG CAG CC‐3' and 5'‐TGA GAC CTT TCA GCT TCT GC‐3'; DR4, 5'‐GCT GTG CTG ATT GTC TGT TG‐3' and 5'‐TCG TTG TGA GCA TTG TCC TC‐3'; c‐FLIP, 5'‐TCT CAC AGC TCA CCA TCC CTG‐3' and 5'‐CAG GAG TGG GCG TTT TCT TTC‐3'; or described elsewhere [9].