Pyromark q24 advanced cpg kit

Individual sperm (n = 36) and blastocysts (n = 24) underwent targeted bisulfite pyrosequencing using the PyroMark Q24 Advanced system (Qiagen). Genomic DNA was isolated using the Norgen RNA/DNA/Protein Kit (Norgen) for sperm and the QIAamp DNA Micro Kit (Qiagen) for blastocysts. Bisulfite conversion was performed using the EZ DNA Methylation‐Direct Kit (Zymo Research), followed by nested PCR amplification with the use of AmpliTaq Gold (Applied Biosystems) and a universal reverse biotinylated primer in the second round. Primers for methylation analysis (CpG) were designed with the use of PyroMark Assay Design Software v.2.0.1.15 (Qiagen) and overlapped ≥ 2 significant CpGs from the originally identified DMR. Pyrosequencing reactions were prepared using the PyroMark Q24 Advanced CpG Kit (Qiagen), and the DNA methylation level was calculated as a ratio of the C to T peaks at a given CpG site using PyroMark Q24 Advanced Software v.3.0.0. (Qiagen). Student's t test and Mann–Whitney U test were used for methylation differences between young and APA cohorts, where p ≤ .05 was considered to be statistically significant. Simple linear regression was used to calculate the association between APA and methylation as age increased. Models with p ≤ .05 were considered significant. Pyrosequencing primers designed in‐house are outlined in Table S9.

Paired ICM and TE blastocyst samples (n = 24) underwent targeted bisulfite pyrosequencing for the KCNQ1OT1 imprinting control region (ICR) using the PyroMark Q24 Advanced system (Qiagen). Bisulfite conversion was performed using the EZ DNA Methylation-Direct Kit (Zymo Research), followed by nested PCR amplification using the Platinum II Hot-Start PCR Master Mix (Invitrogen); Pyrosequencing primers were designed in-house with the use of PyroMark Assay Design Software v.2.0.1.15 (Qiagen). Forward primer: GAGTTTATGGTAATGTTTGGTATTTAGAAG, Reverse primer: CGCCAGGGTTTTCCCAGTCACGACCCAAACCACCCACCTAACAAA, universal reverse biotinylated primer in the second round: 5’Biotin-CGCCAGGGTTTTCCCAGTCACGAC, and Sequencing primer: GATGGGAGGTGGGTA. Pyrosequencing reactions were prepared using the PyroMark Q24 Advanced CpG Kit (Qiagen), and the DNA methylation level was calculated as a ratio of the C to T peaks at a given CpG site using PyroMark Q24 Advanced Software v.3.0.0. (Qiagen). Student’s t test was used for methylation differences between young and APA cohorts of ICM or TE, where p ≤ 0.05 was considered to be statistically significant.