Stepone real time pcr detection thermal cycler

Circulating cells from 10 larvae were isolated in 20 μL of 1× PBS for each biological replicate and total RNA was extracted using the PureLink RNA mini kit (Ambion) and quantitated using a spectrophotometer (Implen). The SuperScript III First-Stand synthesis SuperMix kit (Invitrogen) and 150 ng of RNA was used for cDNA synthesis and relative quantitative PCR was performed by comparative C_T method using Power SYBR Green PCR master mix kit (Applied Biosystems) with a StepOne Real-Time PCR detection thermal cycler (Applied Biosystems). Primers used in this study were either from published literature or designed using Primer3, and the expression level of RpL32 was used to normalize total cDNA input in each experiment. Primer sequences (5′–3′) are as follows: Drs: (forward) CGTGAGAACCTTTTCCAATATGA, (reverse) TCCCAGGACCACCAGCAT; Mmp1: (forward) GGCAGAGGCGGGTAGATAG, (reverse) TTCAGTGTTCATAGTCGTAGGC; upd: (forward) AACTGGATCGACTATCGCAAC, (reverse) CTATGGCCGAGTCCTGGCTAC; upd2: (forward) CCAGCCAAGGACGAGTTATC, (reverse) GCTGCAGATTGCCGTACTC; upd3: (forward) ACAAGTGGCGATTCTATAAGG, (reverse) ATGTTGCGCATGTACGTGAAG; mys: (forward) GATCACGGTACATGCGAGTG, (reverse) GTACCATGACCGGAGCAGAT; chinmo: (forward) CAGTGCCAATGAGGCTAATG, (reverse) TCAAGTTCTCCAGCTTCACG; Rpl32: (forward) GACGCTTCAAGGGACAGTATCT, (reverse) AAACGCGGTTCTGCATGAG.

RNA from blood cells were extracted from 30 third instar larvae. First strand cDNA was synthesized using ReverTra ACE^® qPCR RT Kit (Toyobo). Relative quantitative PCR was performed by comparative C_T method using SYBR Green^® Realtime PCR Master Mix (Toyobo) and StepOne Real-time PCR detection thermal cycler (Applied Biosystems). Two sets of primers were used to detect Fer1HCH mRNA. Primer set 1: 5′-CTGCTCCTGTTGGCCGTGGT-3′ (Forward) and 5′-TCCTT CATGTCCACCCAGTCCT-3′ (Reverse). Primer set 2: 5′-ATGGT GAAACTAATTGCTAGC-3′ (Forward) and 5′-TCAGATCGCTG ACTCCCTC-3′ (Reverse). Levels of RpL32 were used to normalize total cDNA.