The largest database of trusted experimental protocols

Pgl 3 basic luciferase report vector

Manufactured by Promega

The PGL-3 Basic Luciferase Report Vector is a plasmid used for gene expression studies. It contains a firefly luciferase gene that serves as a reporter for monitoring transcriptional activity. The vector can be used to assess the effects of regulatory sequences on gene expression in various cell types.

Automatically generated - may contain errors

2 protocols using pgl 3 basic luciferase report vector

1

Cloning and Characterization of Chicken Hsd3b Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 5'-regulatory region of Hsd3b was cloned from chicken genomic DNA by long PCR (S1 Table). The amplified fragment spans the region between −3544 to +7 bp of the chicken Hsd3b gene, where +1 is the transcription initiation site. PCR products were cloned into the pGL-3 basic luciferase report vector (Promega) using the NheI and XhoI restriction sites. This construct was named −3544 HSD3Bpr-luc. Deletion constructs −2220 HSD3Bpr-luc, −1457 HSD3Bpr-luc, −665 HSD3Bpr-luc, and −215 HSD3Bpr-luc were generated by PCR, with −3544 HSD3Bpr-luc as the template, and confirmed by bidirectional sequencing. Granulosa cells were plated on 24-well plates for transient transfection experiments. The cells were transfected with the luciferase reporter plasmids (800 ng/well) using Lipofectamine 2000 (Invitrogen). Transfection efficiency was normalized by cotransfection of 30 ng of the Renilla luciferase reporter plasmid (pRL-CMV vector; Promega). At 24 h after transfection, recombinant TGF-β1 was added. At 48h after transfection, the cells were lysed and assayed for promoter activity using the dual-luciferase reporter assay system. The enzymatic activity of luciferase was measured with a luminometer (Modulus TM, Turner Biosystems).
+ Open protocol
+ Expand
2

Cloning and Characterizing LONP1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
LONP1 promoter sequences were amplified from genomic DNA of MKN28 cells by PCR using the following primers with MluI and BglII restriction sites, digested, and ligated into pGL3-Basic luciferase report vector (Promega), which encodes firefly luciferase. HIF-1α stable or control cells were transfected with firefly luciferase reporter plasmid (200 ng) and control reporter plasmid pAct-Renilla (40 ng), which encodes Renilla luciferase, using Effectene (Qiagen). The ratio of firefly to Renilla luciferase activity was determined using the Dual-Luciferase Assay System (Promega).
− 435/− 415-Forward: GCTCTTACGCGTGGGAGTCGCTGCACAATCCGA− 338/− 318-Forward: GCTCTTACGCGTCTCCGCCTGAATCTTGAGCAT+ 1/+ 22-Forward: ATGCTCTTACGCGTAGCTCCCTGAAGCGGCTGTTTC+ 71/+ 92-Reverse: TTACTTAGATCTTCATTTCCGCTCGCCGCGAAAC
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!