Trcn0000310888

Rac1 CDS-targeting- and Bcl2l1 CDS-targeting shRNA in lentiviral plasmid (TRCN0000310888 and TRCN0000004685) and control shRNA (SHC216V) were purchased from Sigma Aldrich. For viral production, 293T cells were transfected with lentiviral gag/pol and VSV-G (courtesy of Donald Kohn, UCLA) and the lentiviral plasmids, at a ratio of 2.2: 1.2: 3.3 (in [μg], gag/pol:VSVG:Plasmid) using Lipofectamine 3000 and P300 Enhancer. Viral particles were collected after 24 h and 48 h. One milliliter of viral supernatant was used to infect 0.75 × 10⁶ BM lin⁻ cells. Infected cells were collected the next day and irradiated with 300 cGy followed by treatment with or without 1 μg/mL DJ001, prior to CFC assay.

The TRC2-pLKO1-puro plasmid containing shRNA for mouse Rac1 (GGAGACGGAGCTGTTGGTAAA, TRCN0000310888) and the nonmammalian shRNA control plasmid (TRC2-pLKO.5-puro non-target shRNA #1) (SHC202) were purchased from Sigma-Aldrich. Either one of these shRNA expression lentiviral plasmids was introduced into HEK-293TN cells with lentiviral packaging plasmids (pMISSION GAG POL and pMISSION VSV-G) using the TransIT-293 Reagent (Takara Bio). Forty-eight hours later, the culture medium containing lentiviruses was collected and then filter-sterilized. 3T3-L1 cells were infected with the lentiviruses at a multiplicity of infection of 4000 in the culture medium supplemented with 7 μg/mL polybrene. Those 3T3-L1 cells that stably expressed shRNA were selected with 2 μg/mL puromycin for three days.