Mir 218 5p mimic

The synthetic miR-218-5p mimic, scrambled mimic, antisense miR-218-5p, scrambled antisense miRNA and EGFR siRNAs were purchased from Genepharma (Shanghai, China). The cells were seeded in 6-well plates on the first day. When the cells had grown to approximately 70% confluent, the transfections were performed with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. For each well, 100 pmol mimic, antisense or siRNA was transfected. The cells were harvested 48 h after transfection for quantitative RT-PCR and western blotting. The siRNA sequences were as follows: EGFR siRNA-1: AACACAGUGGAGCGAAUUCCU; and EGFR siRNA-2: CGCAAAGUGUGUAACGGAAUA.

Small interference RNAs (siRNAs) specifically targeting to hsa-circ_0028171 and IKBKB, miR-218-5p mimic, inhibitor and their negative controls were generated by Gene-Pharma (Shanghai, China). TO induce the overexpression of circ_0028171 and IKBKB, KBKB,0028171verexprs were cloned into pEX-3 vector, respectively (Shanghai GenePharma CO. Ltd). All above vectors were transfected with Lipofectamine®ipofectInvitrogen, Thermo Fisher Scientifific, USA). After transfection for 48 h–72 h, transfection efficiency was measured by qRT-PCR.

Lentivirus-containing short hairpin RNA (shRNA) targeting SNHG12 was purchased from OBiO (Shanghai, China), the sequences are as follows: sh-SNHG12-1: CcggGCTGTCCTCATTTGTGACTTTCAAGAGAAGTCACAAATGAGGACAGCTTTTTTg, sh-SNHG12-2: CcggCCTATGGAGTTGGGACAATTTCAAGAGAATTGTCCCAACTCCATAGGTTTTTTg. And the pCDH-CMV-Human vector for SNHG12 overexpression was purchased from Allwin (Shanghai, China). miR-218-5p mimics, miR-218-5p inhibitors, and negative control (NC) oligonucleotides were obtained from GenePharma (Shanghai, China). SiRNAs for YY1, YWHAZ and HuR were obtained from Sangon Biotech (Shanghai, China), sequences are listed as follows: si-YY1 sense (5'-3'): CCAAACAACUGGCAGAAUUTT, antisense (5'-3'): AUUCUGCCAGUUGUUUGGTT; si-HuR sense (5'-3'): GCGUUUAUCCGGUUUGACAtt, antisense (5'-3'): UGUCAAACCGGAUAAACGCtt; si-YWHAZ sense (5'-3'): GATGACATGGCAGCCTGCATGAAGT. GC cells were transfected with the abovementioned oligonucleotides and plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.