The largest database of trusted experimental protocols

Sterile distilled water

Manufactured by Merck Group
Sourced in United Kingdom, United States

Sterile distilled water is a laboratory-grade water that has been purified and sterilized to remove impurities and microorganisms. It is a clear, odorless liquid that meets stringent purity standards for use in various laboratory applications.

Automatically generated - may contain errors

4 protocols using sterile distilled water

1

Evaluating Nanoparticle Cytotoxicity in Osteosarcoma and Mesenchymal Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MG-63, an osteosarcoma cell line (Lonza, UK) and human bone marrow derived primary mesenchymal stem cells (less than 5 passages) (Lonza, UK) were seeded in expansion media consisting of 4.5 gL−1 glucose Dulbecco’s Modified Eagle’s medium (Lonza, UK) supplemented with 10% foetal bovine serum, 1% Penicillin/Streptomycin (antibiotics and antimycotics) and 1% L-glutamine in well plates at ~80% confluency and allowed to attach overnight before addition of nanoparticle suspensions. hMSCs were adherence selected and tested for stemness using standard trilineage differentiation and flow cytometry for CD markers. Aqueous suspensions of the nanoparticles were mixed with cell culture media at 10% v/v and then added to cells. For the control samples, equivalent amount of sterile distilled water (negative control) or sterile cobalt chloride solution (positive control; Sigma- Aldrich, UK) at a concentration of 500 μM were mixed with the cell culture media and added to cells. The cation/MNP concentrations were maintained constant between comparisons and cells were incubated with the additives for 72 h before being assessed.
+ Open protocol
+ Expand
2

Coating Procedures for Cell Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
The coating procedure was performed as described elsewhere (Dos-Santos-Pereira et al., 2018 (link); Dos-Santos-Pereira et al., 2020 (link)). For astrocyte cultures, bottom surfaces of culture flasks were coated with 1 μg/ml laminin dissolved in sterile distilled water (Sigma Aldrich). For microglial and neuronal cell cultures, we used a borate buffer solution (pH 8.3) containing 1 mg/ml polyethyleneimine (PEI; Sigma Aldrich). After at least 2 h at 37 °C, culture flasks were washed with Dulbecco’s phosphate-buffered saline (PBS) four times before applying culture medium and cell seeding.
+ Open protocol
+ Expand
3

Standardized Avian Vaccine Stabilization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The standard vaccine stabilizer was prepared according to the Malaysian Vaccines and Pharmaceuticals (MVP) protocol, Malaysia. The standard vaccine stabilizer was prepared by adding 0.68 g of sodium dihydrogen phosphate (Sigma, USA), 0.125 g of potassium phosphate (Sigma), 74.6 g of sucrose (Sigma), and 10 g of bovine serum albumin (Sigma) to 10 mL sterile distilled water (Millipore, USA). The pH was then adjusted to 6.8 and filtered through a 0.22 µm syringe filter (Sartorius, Germany). Briefly, 1 mL of mIBS025 vaccine virus in the form of an allantoic fluid was mixed with 0.5 mL of standard stabilizer (MVP, Malaysia). The mixture was vortexed for 3 sec then freeze-dried for 24 h. The vaccines were resuspended in 1.5 mL phosphate-buffered saline (PBS) and subjected to an 50% of the embryo infectious dose (EID50) titration to determine the required virus titer for vaccination at 106 EID50/0.1 mL. The standard mIBS025 vaccine was then filtered through a 0.45 µm syringe filter (Sartorius) before the vaccination of the experimental chicks.
+ Open protocol
+ Expand
4

Prolactin Gene Promoter SNP Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polymerase chain reaction was carried out using specific set of forward (F-5"AGAGGCAGCCCAGGCATTTTAC3") and reverse primer(R-5"CCTGGGTCTG GTTTGGAAATTG3") to amplify the 439bp fragment of prolactin gene containing single nucleotide polymorphism C-2161G in promoter region. Each diluted primer (10 pM/µl) was added to the template DNA [working solutions prepared from stock solution by diluting with sterile distilled water (Millipore) to get a final concentration of 100 ng/µL] and 2X PCR Smart Mix (origin) in a PCR tube and made upto the final volume of 20 µL using ultra-filtered Millipore water.
PCR was done in Bio-Rad thermal cycler and standardization was done for each reaction by mild adjustment of concentration of ingredients and annealing temperature with the following profile: initial denaturation of 5 min at 94°C; 35 cycles of 94°C for 30 s, annealing at 67.7°C for 30 s, and 72°C for 30 s with a final elongation of 5 min at 72°C. PCR amplicon was subjected to 2% agarose gel.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!