Mice were euthanized by cervical dislocation after the treatment period. The brains were immediately removed from the skulls, and the hippocampi were dissected, frozen and maintained at −80°C. Total RNA isolation from hippocampal samples was performed using the TRIzol® reagent according to the manufacturer’s instructions (Bioline Reagent, London, UK). The yield, purity and quality of RNA were determined spectrophotometrically with a NanoDrop™ND-1000 apparatus (Thermo Fisher, Waltham, MA, USA) and an Agilent 2100B Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA samples with 260/280 ratios and RINs higher than 1.9 and 7.5, respectively, were selected. A reverse transcription-polymerase chain reaction (RT-PCR) was performed. Briefly, 1 μg and 2 μg of messenger RNA (mRNA) were reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) for PCR array performance and q-PCR validation, respectively.
Nanodrop nd 1000 apparatus
Manufactured by Thermo Fisher Scientific
Sourced in United States
The NanoDrop ND-1000 is a spectrophotometer used for the quantification and analysis of small volume samples. It utilizes a patented sample retention technology to measure absorbance directly from 1 to 2 microliters of sample without the need for cuvettes or capillaries.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (3 mentions)
Agilent 2100b bioanalyzer, by Agilent Technologies (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Peasy t1 cloning kit, by Transgene (1 mentions)
Gfxtm pcr dna and gel band purification kit, by GE Healthcare (1 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions)
Gelred, by Biotium (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna kit, by Qiagen (1 mentions)
Surehyb hybridization chamber, by Agilent Technologies (1 mentions)
Quick amp labeling kit, by Agilent Technologies (1 mentions)
Agilent dna microarray scanner, by Agilent Technologies (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Feature extraction software, by Agilent Technologies (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Random primer, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr mix, by Thermo Fisher Scientific (1 mentions)
Human β actin, by Thermo Fisher Scientific (1 mentions)
9 protocols using nanodrop nd 1000 apparatus
1
Hippocampal RNA Isolation and Profiling
2
Construction and Validation of pEASY-T1-STY2879 Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reference plasmid pEASY-T1-STY2879 was constructed as follows: the full length STY2879 gene, which was from the S. Typhi strain CT18, was amplified by a set of primers, STY2879-F: 5’-3’ ttacaacttaaagagtttcgc and STY2879-R: 5’-3’ atgacaatagaagttcaaagg, and the PCR products (774 bp) were ligated into the pEASY-T1 vector according to the pEASY-T1 Cloning Kit (Transgen, Beijing, China). The recombinant plasmid designated pEASY-T1-STY2879 was confirmed by sequencing. To test the sensitivities of the STY2879-LAMP assay and RT-PCR, we quantified the concentration of the recombinant plasmid by a NanoDrop ND-1000 apparatus (Thermo Scientific) and 10-fold serially diluted the plasmid from 105 to 100 copies/μL to define the limit of detection. The concentration (ng/μL) of the plasmid was converted to the copy number using the formula: mol/g × molecules/mol = molecules/g.
3
Genomic DNA Extraction and HIV-1 NFLG Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The patients’ genomic DNA containing their HIV-1 proviruses was extracted from whole blood with the Genomic DNA Extraction Kit (Real Genomics, BioAmerica, Inc.) following manufacturer’s instructions. Nested PCR performed using PlatinumTM Taq DNA Polymerase High Fidelity (Life Technologies) was carried out in a Veriti® 96-Well Thermal Cycler (Life Technologies, Carlsbad, United States) for the amplification of HIV NFLGs. The strategies comprised the amplification of four to five fragments, from 2 to 3 kb each, spanning the whole HIV genome (Sanabani et al., 2006b (link); Ode et al., 2015 (link)). After visualization using GelRed (Biotium, Hayward, CA, United States) in 1% agarose gels, duplicated independent PCR-positive products were pooled directly to avoid representativeness of PCR-based errors and their interpretation as minority variants in the population. PCR products were purified with the GFXTM PCR DNA and Gel Band Purification Kit (GE Healthcare, MA, United States) and their concentration was measured in a NanoDrop ND 1000 apparatus (Thermo Fisher Scientific, MA, United States). The purified products were diluted to 4 ng/μL and pooled per patient.
4
Quantitative PCR Analysis of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared with the total RNA isolation kit RNeasy Mini Kit (Qiagen, Valencia, CA). After quantification on a NanoDrop ND-1000 apparatus (NanoDrop Technologies, Rockland, DE), reverse transcription was performed with 1 µg RNA using a reverse transcription kit from Applied Biosystems (Courtaboeuf, France). Quantitative PCR was carried out on a 7900HT Fast-Real Time PCR system (Applied Biosystems) using pre-developed TaqMan® Gene Expression assays (Applied Biosystems), with GAPDH as housekeeping gene. Relative mRNA was quantified using the ΔΔCT method. DataAssistTM software (Life Technologies) was used to perform hierarchical clustering with global normalization and Pearson’s correlation.
5
Genetic Profiling of Colon Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty-eight colon tumor cell lines in log-phase growth were harvested and washed twice with cold PBS; 1x107 cells from each colon cancer line were collected and resuspended in 400 μl of PBS. The QIAamp DNA kit (catalog no. 51304, Qiagen, Gaithersburg, MD) was used for Genome DNA collection and purification for each cell line according to the manufacturer’s protocol. Following purification, DNA concentration and purity were measured on the Nanodrop ND-1000 apparatus (Nanodrop Technologies, Wilmington, DE). The DNA samples were then shipped to the CLIA Molecular Diagnostics Laboratory, Leidos Biomedical Research, Inc. (Frederick, MD) for detection of HRAS, KRAS, and NRAS mutations by Sanger sequencing. Transcribed RNA regions were analyzed and compared to the published gene sequences to identify variants.
6
Liver Transcriptome Analysis via Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from the liver using TRIzol (Invitrogen) and the RNeasy kit (Qiagen); this procedure included a DNase digestion step. RNA was quantified using a Nanodrop ND-1000 apparatus (NanoDrop Technologies, Wilmington, DE, USA). RNA quality was verified with denaturing gel electrophoresis. Samples were amplified and labeled using the Agilent Quick Amp labeling kit and hybridized using an Agilent 4×44K whole-genome oligo microarray in Agilent SureHyb Hybridization Chambers. After hybridization and washing, microarray slides were scanned using the Agilent DNA microarray scanner (G2505B). Text files of results were extracted using Agilent Feature Extraction Software (version 10.5.1.1) and imported into Agilent GeneSpring GX software (version 10.0). Genes differentially expressed between the 2 groups were defined as >2.0 fold-change and P<0.05 between the 2 groups at each time point. Identified genes were analyzed using the KEGG PATHWAY Database (http://www.genome.jp/kegg/ ). Two-sided Fisher's exact test was used to classify enriched pathways. Enrichment was defined by (a/n)/(A/N), where a represents the number of target genes; n, the total number of genes in the particular pathway; A, the total number of differentially expressed genes in all the pathways; and N, the total number of genes in all the pathways.
7
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time PCR (qPCR), total RNA was extracted from cells using the RNeasy Mini Kit (catalog no. 74104; Qiagen) according to the manufacturer's instructions. Following isolation, RNA concentrations and purity were measured on the Nanodrop ND-1000 apparatus (Nanodrop Technologies, Wilmington, DE). Two μg of total RNA was used for cDNA synthesis, and combined with SuperScript II reverse transcriptase (catalog no. 100004925; Invitrogen) and random primers (catalog no. 48190-011; Invitrogen) in a 20 μL reaction system. Cycling conditions were as follows: 25 °C for 10 min, 42 °C for 50 min, 70 °C for 15 min. After reaction, the products were diluted with H2O to 100 μL and RT-PCR was performed on 384-well plates in a 20 μL reaction system containing 2 μL of diluted cDNA and 1 μL of appropriate primer. Human NOX4 primer (catalog no. Hs00418356_m1), mouse NOX4 primer (catalog no. Mm00479246_m1), human CYBA (p22phox, catalog no. Hs00164370_m1), human β-actin (catalog no. Hs99999903_m1), and TaqMan Universal PCR mix (catalog no. 4364340) were purchased from Applied Biosystems for the reaction. PCR amplification was performed on an ABI 7900HT sequence detection system (Applied Biosystems, Foster City, CA). Relative gene expression was calculated as the ratio of the target gene to the internal reference gene (β-actin) multiplied by 106 based on the Ct values.
8
Gene Expression Analysis of Skin Biopsies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from skin biopsies using RNeasy Fibrous Tissue Mini Kit (Qiagen), according to the manufacturer’s recommendations. Total RNA integrity was analyzed using Agilent 2100. After quantification on a NanoDrop ND-1000 apparatus (Nanodrop Technologies, Rockland DE, USA), 1 µg of total RNA was used for reverse transcription (RT) using the High Capacity Reverse Transcription Kit (Life Technologies, Paisley, UK) according to the manufacturer’s instructions. PCR amplification was performed using Taqman PCR master Mix (Life Technologies) with the ABI PRISM 7900 Sequence detection system (Life Technologies).
TaqMan gene expression assays were used as follows: Coll1a1 (Mm00801666_g1), Coll1a2 (Mm00483888_m1), Coll3a1 (Mm00802331_m1), ICAM-1 (Mm00516023_m1), IL6 (Mm00446190_m1), IL10 (Mm00439616_m1), MCP1 (Mm00441242_m1). To calculate relative gene expression levels between different samples, we used the threshold cycles (Cts) normalized to the Ct of GAPDH as an internal control (TaqMan® Rodent GAPDH, Life Technologies). Relative mRNA quantification was performed by using the comparative ΔΔCT method.
TaqMan gene expression assays were used as follows: Coll1a1 (Mm00801666_g1), Coll1a2 (Mm00483888_m1), Coll3a1 (Mm00802331_m1), ICAM-1 (Mm00516023_m1), IL6 (Mm00446190_m1), IL10 (Mm00439616_m1), MCP1 (Mm00441242_m1). To calculate relative gene expression levels between different samples, we used the threshold cycles (Cts) normalized to the Ct of GAPDH as an internal control (TaqMan® Rodent GAPDH, Life Technologies). Relative mRNA quantification was performed by using the comparative ΔΔCT method.
9
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA analysis, RNAs were prepared using the Rneasy Mini Kit (Qiagen). For miRNA analysis, total RNAs were prepared using the mirVana miRNA isolation kit (Thermo Fisher Scientific). RNA concentrations were quantified on a NanoDrop ND-1000 apparatus (NanoDrop Technologies), and miRNA quality was checked using an Agilent Bioanalyser. Experiments were performed in 3 replicates for each dose of irradiation and each time point of the kinetic.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!