Mcherry lifeact 7

Mouse NDRG1_OMu19504D, BNIP3_OMu13517D and CDC42_OMu16203C_cDNA expression plasmids were synthesized by GenScript USA. NDRG1_OMu19504D and BNIP3_OMu13517D were each cloned into pcDNA3.1+/C-(K)-DYK vector. CDC42_OMu16203C was cloned into pcDNA3.1(+)-N-eGFP vector. cDNA encoding NDRG1^Thr328Ala, NDRG1^Thr328Asp, NDRG1^Ser332Ala, NDRG1^Ser332Asp, NDRG1^Ser336Ala, NDRG1^Ser336Asp, BNIP3^Ser79Ala or BNIP3^Ser88Ala_pcDNA3.1+/C-(K)-DYK mutants was generated by site-directed mutagenesis. pcDNA3.1+/C-(K)-DYK or pcDNA3.1(+)-N-eGFP vectors were negative controls. For live-cell imaging, mouse NDRG1_OMu19504D WT, mutant NDRG1^Ser336Ala and CDC42_OMu16203C WT plasmids were each cloned into a pcDNA3.1(+)-mCherry vector. cDNA encoding CDC42^Thr17Asn_pcDNA3.1(+)-mCherry mutant was generated by site-directed mutagenesis. mCherry–Lifeact-7 was a gift from M. Davidson (Addgene, 54491).

The mStayGold gene was amplified using primers containing 5′-BamHI and 3′-NotI sites and the restricted product was substituted for the mCherry gene at the BamHI/NotI sites of mCherry-Lifeact-7 (#54491, Addgene).

We used Eurogentec-synthesized siRNA to deplete endogenous mRNA from CHO cells. Cricetulus targeting sequences were as follows: for luciferase, 5′ CGUACGCGGAAUACUUCG(dT)(dT)3′; for Mec-17, 5′ CCACACCAACUGGCCAUUGA (dT)(dT)3′; for TTLL5, two oligo sequences were mixed, 5′ CAGCAACAGGCCACAGA(dT)(dT)3′ and 5′ CAGGCGGAACCCUUUUCAAAG(dT)(dT)3′; and for TUBB1, 5′ AACAAGAUCAGGGAGGAA U (dT)(dT)3′.
Plasmid sfGFP-EB3-7 (Addgene plasmid # 56481) and Plasmid mCherry-Lifeact-7 (Addgene plasmid # 54491) were gifts from Michael Davidson.
siRNA/plasmids were transfected for 48/24 h using Lipofectamine/RNAiMAX or Lipofectamine/plus reagents (Invitrogen). CHO cells were serum starved (2 h), washed and seeded on fibrinogen-coated (50 μg mL⁻¹) glass coverslips. Drugs were added 30 min to 2 h after seeding. For MLN8237 (400 nM)-induced polyploidization, cells were treated 24–48 h prior to transfection and until the end of the experiment. SiR Tubulin was applied on cells overnight at 80 nM with 2 μM verapamil, the day before spreading cells on fibrinogen.