Stepone software version 2

Manufactured by Thermo Fisher Scientific

Sourced in United States

StepOne Software version 2.3 is a computer program designed for real-time PCR data analysis. It provides a user interface for setting up, monitoring, and analyzing real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

125 protocols using stepone software version 2

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Briefly, total RNA was isolated by TriReagent (Molecular Research Centre, Inc., Cincinnati, OH, USA). Total RNA (1 μg) was reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific). Gene-specific TaqMan assays (Thermo Fischer Scientific) were used to perform qPCR in a final volume of 12.5 μl in triplicates using DreamTaq DNA polymerase and ABI StepOnePlus real-time PCR instrument. Amplification of h36B4 was used as normalizing controls using specific primers and probe (Integrated DNA Technologies, Coralville, IA, USA). Cycle threshold values were determined using the StepOne Software, version 2.1 (Thermo Fischer Scientific). The sequences of the primers and probes are available upon request.

Bene K., Varga Z., Petrov V.O., Boyko N, & Rajnavolgyi E. (2017). Gut Microbiota Species Can Provoke both Inflammatory and Tolerogenic Immune Responses in Human Dendritic Cells Mediated by Retinoic Acid Receptor Alpha Ligation. Frontiers in Immunology, 8, 427.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time polymerase chain reaction (PCR) primers were designed with primer Premier 5 software (PREMIER Biosoft International, Palo Alto, CA, USA) (Table 1). β-Actin was used as the reference gene, and all of the PCR products were ~200 bp. Total RNA was isolated by TRIzol reagent (Thermo Fisher Scientific), and 1 μg of total RNA was reverse-transcribed into cDNA with the RevertAid First Strand cDNA Synthesis Kit (Fermentas). Quantitative real-time PCR was carried out using SYBR Green Real-time PCR Master Mix (Toyobo, Tokyo, Japan) on the ABI StepOnePlus real-time PCR system (Thermo Fisher Scientific). The PCR amplification conditions were 95°C for 2 minutes, followed by 40 cycles of 5 seconds at 95°C, 56°C for 15 seconds, and 72°C for 20 seconds. The threshold cycle number for each PCR product was estimated, and the relative expression levels for genes were obtained using the 2^−ΔΔCt method with the StepOne software version 2.1 (Thermo Fisher Scientific). Experiments were performed in triplicate biological replicates.

Gao F., Ma N., Zhou H., Wang Q., Zhang H., Wang P., Hou H., Wen H, & Li L. (2016). Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes. International Journal of Nanomedicine, 11, 3859-3874.

+ Open protocol

+ Expand

Quantifying Inflammatory Cytokines in Primary Human Monocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (DNase treated) from primary human monocytes was extracted using an RNeasy Mini kit (Qiagen NV, Venlo, the Netherlands) and the QIAcube robotic work station (Qiagen NV), following the manufacturer’s instruction. Reverse transcription of RNA to complementary DNA was performed using a high-capacity RNA-to-cDNA kit (Thermo Fisher Scientific), and the concentration and purity of the RNA were determined using NanoDrop (Thermo Fisher Scientific). Perfecta qPCR FastMix™ (Quanta) and the following TaqMan probes (Thermo Fisher Scientific) were used: TNFα (Hs00174128_m1), IL-6 (Hs00985639_m1), IL-1β (Hs01555410_m1), IFNβ1 (Hs01077958_s1), and TBP (Hs 00427620_m1). Triplicate samples were run as singlets in polymerase chain reaction, and all data were normalized to TBP. Relative gene expression was calculated as fold induction over control, using the StepOne software Version 2.1 (Thermo Fisher Scientific).

Grosse S., Stenvik J, & Nilsen A.M. (2016). Iron oxide nanoparticles modulate lipopolysaccharide-induced inflammatory responses in primary human monocytes. International Journal of Nanomedicine, 11, 4625-4642.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Blastocyst Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real time-polymerase chain rection (qRT-PCR) assays were performed as previously described (Ezoe et al., 2014a (Ezoe et al., , 2014b)) , with slight modification. Blastocysts were collected 0, 12, 18, and 24 h after assisted hatching treatment followed by plating on the fibronectin-coated dish and stored at -80°C until use. Total RNA was extracted and was reverse transcribed using Cells-to-CT™ Kits (4399002, Thermo Fisher Scientific, Waltham, MA, USA). The TaqMan® Gene Expression Assay (Thermo Fisher Scientific) was used for quantify-ing the mRNA levels of integrin α5 (ITGA5, Hs01547673_m1) and integrin β1 (ITGB1, Hs00559595_m1) genes. PCR amplification was performed in a total volume of 20 μl per reaction by using the TaqMan® Fast Universal PCR Master Mix (4352042, Thermo Fisher Scientific) and a StepOnePlus™ Realtime PCR System (Applied Biosystems, Thermo Fisher Scientific). Each sample was assayed in duplicate, and the expression of each target gene was normalized relative to that of H2A histone family member Z (H2afz, Hs01888362_g1). Relative gene expression was quantified according to the standardcurve method by using StepOne software Version 2.1 (Thermo Fisher Scientific).

Ueno S., Ezoe K., Yabuuchi A., Uchiyama K., Okimura T., Okuno T., Kobayashi T, & Kato K. (2016). Complete zona pellucida removal from vitrified-warmed human blastocysts facilitates earlier in-vitro attachment and outgrowth. Reproductive biomedicine online, 33(2).

+ Open protocol

+ Expand

Quantifying Transgene Copy Number

Check if the same lab product or an alternative is used in the 5 most similar protocols

For average copy number quantification, cells were harvested two days posttransfection and one tenths of the cells in parallels were selected in puromycin for 3 weeks. Cells from parallels were pooled and genomic DNAs were isolated by the standard phenol-chloroform extraction method. Average copy numbers were quantified with a TaqMan ® assay specific for the IRDR-L (left transposon sequence), normalizing to the level of the RPPH1 endogenous control gene as described previously (Kolacsek et al., 2011) .
Briefly, all samples were run in triplicate singleplex reactions, using 100 ng of gDNA template, in a final volume of 20 l. Real-time PCR measurements were performed on a
StepOnePlus™ platform, and data were analyzed by the StepOne software version 2.1, according to the manufacturer's instructions (Thermo Fisher Scientific).

Kolacsek O, & Orbán T.I. (2018). Transcription activity of transposon sequence limits Sleeping Beauty transposition. Gene, 676.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Fracture Callus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Six callus specimens were harvested at days 3, 5, 7, 10, and 14. Muscles and original bones were excluded from the callus. Total RNA was extracted using Trizol (Invitrogen Corp., Carlsbad, California, USA) and an RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized from total RNA using RT buffer, RT random primers, dNTP mix, and Multiscribe reverse transcriptase (Applied Biosystems, Foster city, CA, USA). A total of 9 μl cDNA diluted 1:9 was added to 10 μl Taqman Universal Master Mix II with Uracil-N glycosylase (Applied Biosystems, Foster City, CA, USA). Real-time amplification of the genes was performed using 1 μl ready-to-use Taqman Gene Expression Assays (Applied Biosystems) for Il1b, Il6, Tnf, Col1a1, Col2a1, Col10a1, and Actb as an endogenous control (assay IDs: Mm00434228_m1, Mm00446190_m1, Mm00443260_g1, Mm00801666_g1, Mm01309565_m1, Mm00487041_m1, and Mm00607939_s1). Relative gene expression data were analyzed using the delta-delta-Ct method with PCR-efficiency correction using StepOne software version 2.2.2 (Applied Biosystems) [24 (link)].

Kamimura M., Mori Y., Sugahara-Tobinai A., Takai T, & Itoi E. (2015). Impaired Fracture Healing Caused by Deficiency of the Immunoreceptor Adaptor Protein DAP12. PLoS ONE, 10(6), e0128210.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). The cDNA was then amplified in an ABI 7500 sequence detection system (Applied Biosystems) using Power SYBR Green PCR Master Mix (Applied Biosystems) under the following cycling conditions: 40 cycles of 95 °C for 5 s, 58 °C for 10 s, and 72 °C for 20 s. The primer sequences for mouse cDNA are described in Supplementary Table S1. The expression of the target genes was normalized to that of the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Quantitative analyses were conducted using the ΔΔcycle threshold method and StepOne Software version 2.2.2 (Applied Biosystems, Waltham, MA, USA).

Seo D.H., Shin E., Lee Y.H., Park S.E., Nam K.T., Kim J.W, & Cha B.S. (2022). Effects of a Phosphodiesterase inhibitor on the Browning of Adipose Tissue in Mice. Biomedicines, 10(8), 1852.

+ Open protocol

+ Expand

Quantitative EBV DNA Detection from Serum

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from cryopreserved pretreatment serum using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. The EBV DNA load was quantified by means of a StepOne sequence detector (Applied Biosystems, Foster City, CA, USA). In brief, DNA samples were mixed with the primers and the TaqMan probe and amplified using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems). Primer sequences were based on the BALF5 gene encoding the DNA polymerase of EBV (5′‐CGGAAGCCCTCTGGACTTC‐3′, 5′‐CCCTGTTTATCCGATGGAATG‐3′), and the probe sequence corresponded to a region between the primers (5′‐TGTACACGCACGAGAAATGCGCC‐3′). The EBV DNA load for each sample was calculated automatically by StepOne software version 2.2.2 (Applied Biosystems). A positive control of DNA from the Namalwa cell line and a negative control of water blanks were included in each analysis.

Okamoto A., Yanada M., Miura H., Inaguma Y., Tokuda M., Morishima S., Kanie T., Yamamoto Y., Mizuta S., Akatsuka Y., Yoshikawa T., Mizoguchi Y., Nakamura S., Okamoto M, & Emi N. (2015). Prognostic significance of Epstein–Barr virus DNA detection in pretreatment serum in diffuse large B‐cell lymphoma. Cancer Science, 106(11), 1576-1581.

+ Open protocol

+ Expand

Genotyping SNPs from Blood DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from blood cells by an initial treatment with 0.5% sodium dodecyl sulfate lysis buffer, followed by proteinase K (1 mg/mL) to digest nuclear proteins, for 4 h at 60°C. Total DNA was harvested using a Gentra (Qiagen, Inc., Valencia, CA) extraction kit followed by 70% alcohol precipitation. Genotyping for four SNPs was carried out using the TaqMan Allelic Discrimination Assay (Applied Biosystems, Foster City, CA). A polymerase chain reaction (PCR) used a 96-well microplate with the ABI9700 Thermal Cycler (Applied Biosystems, Foster City, CA). After the PCR, StepOne software, version 2.2.2 (Applied Biosystems, Foster City, CA), was used to detect and analyze the fluorescence.

Wang Y.J., Hsu Y.W., Chang C.M., Wu C.C., Ou J.C., Tsai Y.R., Chiu W.T., Chang W.C., Chiang Y.H, & Chen K.Y. (2014). The Influence of BMX Gene Polymorphisms on Clinical Symptoms after Mild Traumatic Brain Injury. BioMed Research International, 2014, 293687.

+ Open protocol

+ Expand

qPCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qPCR primer sequence sets were designed using the OligoPerfect Designer website (Invitrogen) (Table 1). PCR based on SYBR green binding was performed for target genes and the 18S ribosomal RNA (normalization). Ten microliter reactions consisted of 2×SYBR Green Master Mix (RT-SN2X-06+, Anaspec, San Jose, USA), 300 pmole primers, and 1 μl of cDNA per well were run on a Step One Plus Real Time PCR System (Applied Biosystems) with cycling conditions of one cycle of 50°C, 2 minutes, one cycle 95°C, 40 cycles of 95°C 15 seconds, 60°C 1 minute. All samples were run in duplicate. StepOne software version 2.2.2 (Applied Biosystems, USA) was used to select a threshold level of fluorescence that was in the linear phase of the PCR product accumulation. Results were determined as the difference between the CT for a specific mRNA and the CT for a reference mRNA, normalized to 18S threshold expression, and was expressed as fold change with the formula 2^-ΔΔCT. Real-time reverse- transcription PCR efficiencies were acquired by the amplification of dilution series of cDNA according to the equation 10( 1/slope) and consistent between target mRNA and 18S mRNA. Control PCR samples replaced cDNA with water and gave a threshold level (CT) value of 40, which indicated no detectable PCR product.

MAGEE T.R., ROSS M.G., WEDEKIND L., DESAI M., KJOS S, & BELKACEMI L. (2014). GESTATIONAL DIABETES MELLITUS ALTERS APOPTOTIC AND INFLAMMATORY GENE EXPRESSION OF TROPHOBASTS FROM HUMAN TERM PLACENTA. Journal of diabetes and its complications, 28(4), 448-459.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!