Rneasy protect mini kit
The RNeasy Protect Mini Kit is a laboratory equipment designed for the purification of RNA from various biological samples. It utilizes a silica-membrane technology to efficiently capture and purify RNA molecules, enabling their subsequent analysis and downstream applications.
Lab products found in correlation
249 protocols using rneasy protect mini kit
DRG and HEK-293 RNA Extraction and cDNA Synthesis
Tick Salivary Gland Transcriptome
RNA Isolation and cDNA Synthesis
RNA Extraction and Sequencing from Worms
Sequencing was carried out on a HiSeq1500 platform (Illumina).
RNA-seq of AOM-DSS-induced Colon Tumors
Profiling Cardiac Fibroblasts: Piezos and Markers
Piezo1 forward primer: TACTGGCTGTTGCTACCCTG;
Piezo1 reverse primer: CCTGTGTGACCTGGTATGCT;
α-SMA forward primer: CCTCTTCCAGCCATCTTTCAT;
α-SMA reverse primer: CGAGAGGACGTTGTTAGCATAG;
GAPDH forward primer: AAGTTCAACGGCACAGTCAAGG;
GAPDH reverse primer: CATACTCAGCACCAGCATCACC.
Resulting data were visualized with CFSX Manager software. Data are shown as 2−(ΔCq) (mean ± STD). For comparisons of two groups, Student’s t-test was used.
Tick Salivary Gland Transcriptome Analysis
Assessing Th1, Th17 Cells and Cytokines in Ankylosing Spondylitis
The total RNA was primarily fetched with RNeasy Protect Mini Kit (Qiagen). Besides, complementary DNA was then synthesized using PrimeScript™ RT reagent Kit (Takara). Meanwhile, qPCR was performed using KOD SYBR® qPCR Mix (Toyobo). Moreover, Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was chosen to be the internal reference for MALT1, and the qPCR process was referred to preceding research.
Quantitative RT-PCR Analysis of Collagen I
Quantification of lncRNA UCA1 Expression in PBMCs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!