Amaxa cell line nucleofector kit 5

Manufactured by Lonza

Sourced in Switzerland, Germany, United States, United Kingdom

The Amaxa Cell Line Nucleofector Kit V is a transfection reagent used for the efficient delivery of DNA, RNA, or other molecules into various cell types, including difficult-to-transfect cell lines. The kit includes the necessary solutions and protocols for the transfection process.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Amaxa Nucleofector (332 citations) Nucleofector Kit V (135 citations) Nucleofector kit (131 citations) Amaxa Nucleofector Kit (71 citations) Amaxa Nucleofector Kit V (57 citations) Kit V (21 citations) Amaxa Kit V (20 citations) Amaxa Nucleofector kit (Kit V) (2 citations) Nucleofector V (2 citations) Amaxa kits (2 citations)

228 protocols using amaxa cell line nucleofector kit 5

Vex-seq and CRISPR base editing in cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Vex-seq transfections, HepG2 cells were grown in 6-well plates to 0.7x10 6 cells/well.
Cells were then transfected with 5μg of plasmid DNA (FuGENE HD Transfection Reagent).
K562 cells were grown to a density of 1x10 6 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit, Promega).
For CRISPR base editing experiments, HepG2 cells were grown in 6-well plates to 0.7x10 6 cells/well. HepG2 cells were then transfected with 1,250ng gRNA plasmid and 3,750ng of either pCMV_AncBE4max_P2A_GFP or pCMV_ABEmax_P2A_GFP [66] (FuGENE HD Transfection Reagent Cat#E2311, Promega). HepG2 cells were cultured for an additional 48 hours then green cells were isolated using flow cytometry (Aria II). K562 cells were grown to 1x10 6 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II). These single clones were cultured for 4 weeks prior to harvesting of genomic DNA and RNA. Genomic DNA from each cell line was isolated (QuickExtract DNA

Adamson S.I., Zhan L., & Graveley B.R. (2021). Functional characterization of splicing regulatory elements.

+ Open protocol

+ Expand

Generation and Transfection of Ezrin Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length wild-type (WT) ezrin cDNA was generated by NZYTech using pCDNA3.1 as the vector. EBV-B cells were transfected with a nucleofection device (Lonza, Basel, Switzerland) and the Amaxa Cell Line Nucleofector Kit V (Lonza) according to the manufacturer’s instructions. The A-024 program was used for EBV-B cell transfection (5 × 10⁶ cells per 5 μg of plasmid).
For Jurkat T-cell studies, various ezrin variants were generated from the full-length WT ezrin in plasmids, with a mutagenesis kit (NZYTech) used according to the manufacturer’s instructions and with the following primers: A129T forward: GTGCTC TTGGGGTCCTACACTGTGCAGGCCAAGTTTG; A129T reverse: CAAACTTGGCCTGCACAGTGTAGGACCCCAAGAGCAC; G109X forward: CTTCCTCCAAGTGAAGGAATGAATCCTTAGCGATGAG; G109X reverse: CTCATCGCTAA GGATTCATTCCTTCACTTGGAGGAAG.
Mutagenesis was confirmed by Sanger sequencing.
Jurkat T cells were transfected with a nucleofection device (Lonza) and the Amaxa Cell Line Nucleofector Kit V (Lonza) according to the manufacturer’s instructions. The U-029 program was used for the transfection of Jurkat T cells (1.8 × 10⁶ cells per 2 μg of plasmid).

García-Solís B., Van Den Rym A., Martinez-Martínez L., Franco T., Pérez-Caraballo J.J., Markle J., Cubillos-Zapata C., Marín A.V., Recio M.J., Regueiro J.R., Navarro-Zapata A., Mestre-Durín C., Ferreras C., Cotázar C.M., Mena R., de la Calle-Fabregat C., López-Lera A., Arquero M.F., Pérez-Martínez A., López-Collazo E., Sánchez-Ramón S., Casanova J.L., Martínez-Barricarte R., de la Calle-Martín O, & de Diego R.P. (2023). Inherited human ezrin deficiency impairs adaptive immunity. The Journal of allergy and clinical immunology, 152(4), 997-1009.e11.

+ Open protocol

+ Expand

Optimized Electroporation for Multiple Cell Types

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The electroporations were performed using a Lonza 2b nucleofector according to the manufacturer's instructions with modifications. 70 μl buffer per reaction was used. For K562 cells, the Amaxa™ Cell Line Nucleofector™ Kit V (Lonza) and program T-016 were used. For U937 cells, the Amaxa™ Cell Line Nucleofector™ Kit V (Lonza) and program W-001 were used. One to two million cells were used for each electroporation. For iPSCs, single-cell suspension of iPSCs was electroporated using Human Stem Cell Nucleofector™ Kit 2 with program B-016. We also added 0.5 μg BCL-XL plasmid to improve iPSC survival (9 (link)). After electroporation, the cuvette was incubated at 37°C for ∼5 min. During the first day after transfection, 10 μM ROCK inhibitor Y27632 was added to the iPSC culture. For T cells, 3 d after initiating T-cell activation, the CD3/CD28 beads were magnetically removed, and 1 × 10⁶ T cells were electroporated using the Lonza Nucleofector 2b (program B-016) and the Human T Cell Nucleofector Kit (VPA-1002, Lonza). Following electroporation, cells were cultured in fresh medium with Dynabeads^® Human T-Activator CD3/CD28 (Gibco) and incubated at 37 °C and 5% CO₂. For HDR editing, the AAV6 donor vector was added at an MOI of 3000 to 10 000 to the culture immediately after electroporation. We removed the AAV6-containing medium and refreshed the culture 24 hours after electroporation.

Fu Y.W., Dai X.Y., Wang W.T., Yang Z.X., Zhao J.J., Zhang J.P., Wen W., Zhang F., Oberg K.C., Zhang L., Cheng T, & Zhang X.B. (2021). Dynamics and competition of CRISPR–Cas9 ribonucleoproteins and AAV donor-mediated NHEJ, MMEJ and HDR editing. Nucleic Acids Research, 49(2), 969-985.

+ Open protocol

+ Expand

STAT3 Signaling Activity Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCDH-BCL9 (BCL9-OE), PLKO.1-BCL9-shRNA (BCL9-KD) (CCTCTGTTGAATATCCCTGGAA), and PLKO.1-non-silencing control (Control) were acquired from Dr. Carrasco^{31 (link)}. For additional shRNA knockdown procedures, pGIPZ Human MMP16 shRNA (MMP16 KD) (Dharmacon #V2LHS_198095), pGIPZ Human ITGAV shRNA (Dharmacon # V2LHS_133468), pGIPZ Human ITGB3 shRNA (Dharmacon #V2LHS_77099), and pGIPZ-non-silencing control (Control) (Dharmacon # RHS4346) were obtained. For STAT3 signaling activity, Cignal STAT3 Reporter (luc) kit (Qiagen # CCS-9028L) was used. Plasmid constructs: Constitutively active STAT3 overexpression, EF.STAT3C.Ubc.GFP (Addgene plasmid 24983) was provided by Linzhao Cheng via Addgene. pLEGFP-Y705F-STAT3 (Addgene plasmid # 71445; http://n2t.net/addgene:71445; RRID:Addgene_71445), pLEGFP-WT-STAT3 (Addgene plasmid # 71450; http://n2t.net/addgene:71450; RRID:Addgene_71450), and pLEGFP-S727A-STAT3 (Addgene plasmid # 71446; http://n2t.net/addgene:71446; RRID:Addgene_71446) were gifts from George Stark. Transfection: DCIS.COM and SUM225 cells were transfected with electroporation using Amaxa^TM Cell line Nucleofector kit V (Lonza #VCA-1003), while HEK293T cells were transfected using Lipofectamine 2000 reagent (Invitrogen #11668-027) according to manufacturer’s protocols. Luciferase assays were performed using the Dual-Luciferase^® Reporter Assay System (Promega #E1910).

Elsarraj H.S., Hong Y., Limback D., Zhao R., Berger J., Bishop S.C., Sabbagh A., Oppenheimer L., Harper H.E., Tsimelzon A., Huang S., Hilsenbeck S.G., Edwards D.P., Fontes J., Fan F., Madan R., Fangman B., Ellis A., Tawfik O., Persons D.L., Fields T., Godwin A.K., Hagan C.R., Swenson-Fields K., Coarfa C., Thompson J, & Behbod F. (2020). BCL9/STAT3 regulation of transcriptional enhancer networks promote DCIS progression. NPJ Breast Cancer, 6, 12.

+ Open protocol

+ Expand

Cloning and Validation of GFP-PRL-3 Fusion Protein

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

GFP-PRL-1 expression vector was previously described [12 (link)]. The mCherry-CD3ζ plasmid was kindly provided by Dr. Alarcon (Molecular Biology Centre, CSIC, Madrid, Spain). PRL-3 cDNA was amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the peGFP-C1 vector from Clontech Laboratories (USA). The resulting construct was sequenced and the expression of the GFP-PRL-3 fluorescent fusion protein verified by Western blot of transfected JK cells (Figure 1B). JK cells were nucleofected with the plasmid GFP-PRL-3 or a mixture of GFP-PRL-3 and mCherry-CD3ζ using the Amaxa NucleofectorTM II system and the AmaxaTM Cell Line Nucleofector Kit V (Lonza, Switzerland). Alive cells were obtained by centrifugation in lymphoprepTM solution.

Aguilar-Sopeña O., Hernández-Pérez S., Alegre-Gómez S., Castro-Sánchez P., Iglesias-Ceacero A., Lazo J.S, & Roda-Navarro P. (2020). Effect of Pharmacological Inhibition of the Catalytic Activity of Phosphatases of Regenerating Liver in Early T Cell Receptor Signaling Dynamics and IL-2 Production. International Journal of Molecular Sciences, 21(7), 2530.

+ Open protocol

+ Expand

Optimized Plasmid Transfection and Microscopy

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected using a Lonza Nucleofector 2b device using the Amaxa Cell line Nucleofector Kit V (Cat. No. VCA-1003). Briefly, 5 × 10⁶ cells were harvested by spinning down at 90 ×g for 10 min; 5 µg of plasmid was mixed with Nucleofector solution and supplement following the manufacturer’s protocol and then added to the pelleted cells. Cells were then transfected using the Nucleofector program M-013 and placed into warm media for overnight incubation. After 24 h, cells were stimulated and imaged on an inverted fluorescence microscope (IX-81; Olympus, Center Valley, PA) set up for TIRF imaging as described in Larson et al. (2014) (link). Only healthy cells expressing levels moderate of transgene were selected for imaging. Previous studies in our lab have found no substantial effects of expression levels on co-localization values across the range of expression levels we commonly use in the lab (Larson et al., 2014 (link); Trexler et al., 2016 (link)).

Roberts A.D., Davenport T.M., Dickey A.M., Ahn R., Sochacki K.A, & Taraska J.W. (2020). Structurally distinct endocytic pathways for B cell receptors in B lymphocytes. Molecular Biology of the Cell, 31(25), 2826-2840.

+ Open protocol

+ Expand

Validating miR-26b-5p Target Genes using Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiR-26b-5p binding sites (wild type and mutated) of the four selected target genes (Table S6) were cloned between the Xhol and NotI restriction sites of the psi-Check-2 vector (Promega, Madison, WI, USA) downstream of the Renilla luciferase reporter gene, driven by the SV40 promoter. This vector also contained the firefly luciferase gene expressed from the TK promoter, which was used for normalization. Luciferase reporter assay was performed, as described previously [30 (link)]. In briefl, the psi-Check-2 vectors with WT or mutated miR-26b-5p binding sites were co-transfected with either 10 µM pre-miR-26b (Cat. NO.: AM17100) or control oligos (Cat. NO.: AM17111) to ST486 cells, using an Amaxa nucleofector device (program A23) and the Amaxa Cell Line Nucleofector Kit V (Cat NO.: VACA-1003) (Amaxa, Gaithersburg, MD, USA). Cells were harvested 24 h after transfection. Renilla and firefly luciferase activities were measured in the cell lysate using a Dual-Luciferase Reporter Assay System (Promega). Each experimental condition was measured in duplicate and the results were averaged. For each construct, the luciferase assay was performed in three independent biological replicates.

Niu F., Kazimierska M., Nolte I.M., Terpstra M.M., de Jong D., Koerts J., van der Sluis T., Rutgers B., O’Connell R.M., Kok K., van den Berg A., Dzikiewicz-Krawczyk A, & Kluiver J. (2020). The miR-26b-5p/KPNA2 Axis Is an Important Regulator of Burkitt Lymphoma Cell Growth. Cancers, 12(6), 1464.

+ Open protocol

+ Expand

Quantifying Cellular Repair Mechanisms

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TLR assay (Certo et al, 2011 (link)) was carried as follows. U2-O-S cells were transduced with lentiviral particles prepared with pCVL. TrafficLightReporter.Ef1a.Puro (#31482; Addgene) at a low multiplicity of infection and selected with 2 μg/ml puromycin (Gibco). The resulting U2-O-S TLR cells were transfected with 10 nM siRNA (Dharmacon) using Lipofectamine RNAiMAX (Thermo Fisher Scientific). 48 h post-transfection, 10⁶ cells were nucleofected with 5 μg of pCVL.SFFV.d14mClover.Ef1a.HA.NLS.Sce(opt).T2A.TagBFP (#32627; Addgene) in 100 μl electroporation buffer (Amaxa Cell Line Nucleofector Kit V) using program X001 on a Nucleofector II (Amaxa). 72 h post-nucleofection, GFP and mCherry fluorescence were measured in BFP-positive cells using a Fortessa X-20 flow cytometer (BD Biosciences).

Gregorczyk M., Pastore G., Muñoz I., Carroll T., Streubel J., Munro M., Lis P., Lange S., Lamoliatte F., Macartney T., Toth R., Brown F., Hastie J., Pereira G., Durocher D, & Rouse J. (2023). Functional characterization of C21ORF2 association with the NEK1 kinase mutated in human in diseases. Life Science Alliance, 6(7), e202201740.

+ Open protocol

+ Expand

SMARCB1 Knockout in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The SMARCB1 locus was targeted by the Ini1 CRISPR/Cas9 KO Plasmid and Ini1 HDR Plasmid (Santa Cruz Biotechnology sc-423027; sc-423027-HDR) in HEK293T Lenti-X cells (Clonetech) following the manufacturer's protocol. Specifically, five million HEK293T cells were co-electroporated with two plasmids (2 μg DNA/plasmid) using the Amaxa Biosystems Nucleofector I and Amaxa Cell Line Nucleofector Kit V. After nucleofection, cells were expanded for 48 hours and GFP⁺/RFP⁺ cells expressing both the KO/HDR plasmids were single-cell sorted through FACS (fluorescence-activated cell sorting). Single-cell clones were expanded further and screened through immunoblot for identification of successful knockouts.

Nakayama R.T., Pulice J.L., Valencia A.M., McBride M.J., McKenzie Z.M., Gillespie M.A., Ku W.L., Teng M., Cui K., Williams R.T., Cassel S.H., Qing H., Widmer C.J., Demetri G.D., Irizarry R.A., Zhao K., J.e.f.f.R.a.n.i.s.h, & Kadoch C. (2017). SMARCB1 is required for widespread BAF complex-mediated activation of enhancers and bivalent promoters. Nature genetics, 49(11), 1613-1623.

+ Open protocol

+ Expand

Efficient Knockdown of CXorf21 in LCLs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene-knockdown of CXorf21 in LCLs (GM12878) was performed by siRNA using the Nucleofector II Device (Lonza) and Amaxa Cell Line Nucleofector Kit V. Two days before transfection, cells were seeded to a concentration of 0.5 × 10⁶ cells/ml. In duplicate, 2 × 10⁶ cells were spun at 100 g for 10 min and re-suspended in 100 μl supplemented transfection solution and 20 pmol Silencer Select Pre-Designed & Validated siRNA (Thermo Fisher Scientific) against CXorf21 (#4392420). The Silencer Select Negative Control No. 1 siRNA (#4390843) was used as a non-targeting negative control at the same concentration. Cell/siRNA suspensions were transferred to a Nucleofector cuvette and electroporated using the X-001 programme. Samples were cultured in 1.5 ml medium in a 12-well plate and harvested 48 h post-transfection.

Odhams C.A., Roberts A.L., Vester S.K., Duarte C.S., Beales C.T., Clarke A.J., Lindinger S., Daffern S.J., Zito A., Chen L., Jones L.L., Boteva L., Morris D.L., Small K.S., Fernando M.M., Cunninghame Graham D.S, & Vyse T.J. (2019). Interferon inducible X-linked gene CXorf21 may contribute to sexual dimorphism in Systemic Lupus Erythematosus. Nature Communications, 10, 2164.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!