All synthetic oligonucleotides were purchased from Eurofins. PCR primers were desalted, DNAzymes were purified by Eurofins proprietary High Purity Salt Free reverse phase cartridge purification system and short RNA substrates were purified by HPLC. RNase-free ultrapure water was produced using a Milli-Q Advantage A10 Water Purification System equipped with a BioPak® Polisher from Merck Millipore. Phusion High-Fidelity PCR kit and TranscriptAid T7 High Yield Transcription kit were from Life Technologies. 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), sodium chloride, manganese chloride tetrahydrate, formamide, bromophenol blue, 40% 19:1 acrylamide/bis-acrylamide, N,N,N′,N′-tetramethylethylenediamine, ammonium persulfate, urea, agarose, ethidium bromide and phenol:chloroform:isoamyl alcohol 25:24:1 pH 8.0 was purchased from Sigma-Aldrich. Ethylenediaminetetraacetic acid (EDTA) and sodium dodecyl sulfate (SDS) were from Scharlau. Boric acid was from VWR. Klorrent bleach was from Nilfisk. The nucleic acid dyes SYTO 61, PO-PRO 1, DRAQ5, Hoechst 33258, DAPI, Propidium iodide and PicoGreen were all from Life Technologies. GelRed was from Biotium. ethidium bromide was from Sigma.
Phusion high fidelity pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Phusion High-Fidelity PCR Kit is a ready-to-use solution for high-fidelity DNA amplification. It contains a proprietary high-fidelity DNA polymerase optimized for accurate DNA replication with enhanced proofreading capabilities.
Automatically generated - may contain errors
Lab products found in correlation
Dneasy blood tissue kit, by Qiagen (6 mentions)
Qiaquick pcr purification kit, by Qiagen (5 mentions)
Phusion high fidelity pcr kit, by New England Biolabs (3 mentions)
Dneasy blood and tissue kit, by Qiagen (3 mentions)
Dneasy plant mini kit, by Qiagen (3 mentions)
Gibson assembly kit, by New England Biolabs (2 mentions)
Quick gdna miniprep kit, by Zymo Research (2 mentions)
Bromophenol blue, by Merck Group (1 mentions)
Transcriptaid t7 high yield transcription kit, by Thermo Fisher Scientific (1 mentions)
Gelred, by Biotium (1 mentions)
Picogreen, by Thermo Fisher Scientific (1 mentions)
Syto 61, by Thermo Fisher Scientific (1 mentions)
N n n n tetramethylethylenediamine, by Merck Group (1 mentions)
Manganese chloride tetrahydrate, by Merck Group (1 mentions)
4 2 hydroxyethyl piperazine 1 ethanesulfonic acid hepes, by Merck Group (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Propidium iodide, by Thermo Fisher Scientific (1 mentions)
Sodium chloride (nacl), by Merck Group (1 mentions)
Draq5, by Thermo Fisher Scientific (1 mentions)
Agarose, by Merck Group (1 mentions)
57 protocols using phusion high fidelity pcr kit
1
Oligonucleotide Synthesis and Purification Protocols
2
Customized Donor Template for CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid donor templates and guide RNA (gRNA) were custom-designed with sequences verified by System Biosciences (SBI). The customised donor template contained a 5′ homology arm, LoxP site, EF1 promoter, reporter genes (eGFP with puromycin resistance gene), a second LoxP site, point of mutation, 3′ homology arm and another reporter gene (extra reporter: PGK promoter with human herpes simplex virus thymidine kinase type 1 gene (HSVtk)). The customised donor template was modified with restriction enzymes from Roche Diagnostics Ltd., Phusion high-fidelity PCR kit (catalogue number F553S, Life Technologies Ltd.) and Mighty Mix DNA Ligation Kit (catalogue number 6023, Takara Bio Europe SAS) to change the puromycin resistance gene to a blasticidin resistance gene amplified from the PSF-CMV-BLAST plasmid (catalogue number OGS588, Sigma-Aldrich Company Ltd.) to create the second donor DNA plasmid. All cloning steps were performed according to manufacturers’ protocols.
3
Backcrossing wild-type Drosophila rab mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serial backcrossing to a wild type (yw) background was performed for three consecutive generations. The single rab mutants as well as the respective balancer chromosomes, used to generate the final stocks, were backcrossed to the same genetic background. All mutant alleles, except rab3 and rab32, could be traced by their red fluorescent marker. Where direct tracing was not possible, backcrossing was performed ‘blindly’ and after three generations roughly 100 separate single (fe-)male stocks were generated and subsequently sequenced to identify the backcrossed rab3 and rab32 mutants.
The genomic DNA was amplified using the Phusion High-Fidelity PCR Kit (Thermo Fisher Scientific) with the following primers for rab3 (Fwd: 5’-ACACTGAGGCGAGCTTACGC and Rev: 5’- CTACTACCGAGGAGCGATGGG ) and rab32 (Fwd: 5’-GTAGACACGGGTCATGTTGCC and Rev: 5’-accagcaaatctcagtgcgg ). The amplified DNA was extracted from agarose gel, cleaned using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and send for sequencing to Microsynth Seqlab GmbH (Göttingen, Germany). Sequencing results were visualized using SnapGene (GSL Biotech LLC). All primers were designed with SnapGene (GSL Biotech LLC).
The genomic DNA was amplified using the Phusion High-Fidelity PCR Kit (Thermo Fisher Scientific) with the following primers for rab3 (Fwd: 5’-
4
Genomic DNA extraction and TTN mutation analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from iPSCs using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s instructions. The primers were designed to include the TTN mutation site of each iPSC line (primers are listed in Table 2 ). Then the PCR was performed using a Phusion High-Fidelity PCR Kit (Thermo Fisher). The purified PCR products were subjected to Sanger sequencing.
5
Identification of Nanometal-Producing Streptomyces
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolates with high productivity of nanometals were identified by amplification and sequencing of the 16S rRNA gene. Spore suspensions of the tested Streptomyces isolates were prepared in sterile water. The spores were boiled for 10 min at 95 °C. The spore suspension was centrifuged at 6000 rpm and the cell lysate was transferred to another tube and kept at −20 °C [87 (link)]. PCR reaction mixture was performed using Phusion High-Fidelity PCR Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturers’ instructions and primer pairs 16S rRNA for (AGAGTTTGATCCTGGCTCAG) and 16S rRNA rev (AGAAAGGAGGTGATCCAGCC). As a negative PCR control, the reaction of PCR master mix without DNA temple was also performed. The conditions of PCR included an initial denaturation cycle at 95 °C for 2 min, repeated 35 cycles at 95 °C for 30 s, 47 °C for 30 s, and 72 °C for 30 s, and a final extension cycle at 72 °C for 10 min. The resulting PCR products were purified and sequenced [88 (link),89 (link)].
6
Bacterial DNA Extraction and 16S rRNA Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total bacterial DNA was extracted from 180–220 mg fecal material using QIAamp DNA Stool Mini Kit (Qiagen, US) according to manufacturer's instructions. DNA concentrations were determined by BioDrop (BioDrop, UK). The 200 bp of the hypervariable V2-V3 regions of the bacterial 16S ribosomal RNA (rRNA) gene were amplified using polymerase chain reaction (PCR) with universal bacterial primers HDA1-GC (5ʹ-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG ACTCCTACGGGAGGCAGCAGT-3ʹ; the GC clamp in boldface) and HDA2 (5ʹ-GTATT CCGCGGCTGCTGGCAC-3ʹ). PCR was performed in 0.2-ml tubes using a high-performance PCR amplification system (Bio-Rad, US). For the amplification of the target DNA sequence, the reaction mixture (20 μl) Phusion High-Fidelity PCR Kit (Thermo, US) was used. PCR reactions were performed under the following PCR conditions: one cycle of initial denaturation at 98 °C for 30 s, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s and extension at 72 °C for 15 s and final extension at 72 °C for 10 min [38] .
7
LMNA Variant Identification via iPSC DNA
8
PCR Amplification of BFP from HEK Cells
9
Nematode Species Identification via ITS2 Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The internal transcribed spacer region 2 (ITS2) of whole nematode isolates was Sanger sequenced to confirm morphological species identifications (Supplementary Table 1 ). ITS2 was amplified using previously published nematode-specific primers, with 5′- AGTGCGAATTGCAGACGCATTGAG-3′ as the forward primer and 5′- AGCGGGTAATCACGACTGAGTTGA-3′ as the reverse primer (Rishniw et al., 2006 (link)). Amplification was done using Thermo Fisher Scientific's Phusion High-Fidelity PCR Kit (Waltham, MA, USA) under the following conditions: 98 °C for 3 min as an initial denaturing step; followed by 35 cycles of 98 °C for 30 s for denaturing, 60 °C for 30 s for annealing, and 72 °C for 1 min for extension; and a final extension of 72 °C for 10 min. PCR products were Sanger sequenced using Thermo Fisher Scientific's BigDye™ Terminator v3.1 Cycle Sequencing Kit (Waltham, MA, USA) following the manufacturer's protocol. Sequences were compared to the GenBank database using NCBI's BLASTn to confirm the species identity of the nematode samples (Altschul et al., 1990 (link); Sayers et al., 2019 (link)).
10
Engineered Fluorescent mGluR Constructs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!