TRIzol® reagent (Takara, Japan) was used to isolate the total RNA from HCC tissues and cells. Next, samples of total RNA were reverse transcribed into cDNA by using a Double-Strand cDNA Synthesis kit (Takara) in accordance with the manufacturer’s instructions. Gene expression was quantified by performing qRT-PCR assays with SYBR Green PCR Master (Takara) on an ABI StepOnePlus Real-Time PCR system. The relative levels of gene expression were calculated using the 2−∆∆CT method.
Sybr green pcr master
Manufactured by Takara Bio
Sourced in Japan, United States, China
SYBR Green PCR Master is a ready-to-use solution for quantitative real-time PCR (qPCR) reactions. It contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescence upon binding, allowing for the detection and quantification of target DNA sequences.
Automatically generated - may contain errors
4 protocols using sybr green pcr master
1
Quantifying Gene Expression in HCC
2
Quantifying Cytokine Levels in Swine Gut
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The levels of IL-6, IL-8, IFN-α, and TNF-α in swine jejunum and colon tissue were detected using qRT-PCR. qRT-PCR was performed using SYBR Green PCR Master [Takara Biotechnology (Dalian) Co., Ltd., Japan] and the primers used were listed in Table 2 . β-Actin was used as the internal control and the date are expressed as fold differences between control and infected pigs using the 2-ΔΔCT method.
3
RNA Isolation and cDNA Synthesis for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated total RNA from BC and para-carcinoma tissues, and from treated MCF10A, MCF7, and MDA-MB-231 cells using TRIzol® reagent (Takara, Dalian, China). The total RNAs were used to synthesize cDNAs using an iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).30 (link) cDNAs were then used as for quantitative analysis of genes using SYBR Green PCR Master (Takara). The obtained data were calculated using the 2−ΔΔCT method. All primer sequences are listed in Table 1 .
4
Real-Time PCR for Viral Gene Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from ST cells using TRIzol reagent (TaKaRa, China) and cDNA was synthesized by using SuperQuick RT MasterMix (TaKaRa, China) according to the manufacturer’s instructions. RT-qPCR was performed using SYBR Green PCR Master (TaKaRa, China) and the specific primers are shown in Table 1 . Data were normalized against β-actin expression and are expressed as fold differences between control and treated cells using the 2−ΔΔCT method.Table 1
Primers used for RT-qPCR in current study.
| Genes | Sequences (5′–3′) | Size (bp) |
|---|---|---|
| β-actin | F: GCGGCATCCACGAAACTAC | 137 |
| R: GATCTCCTTCTGCATCCTGTC | ||
| TGEV M | F: ATGGTAGAACTGGTGTTGGTATT | 120 |
| R: CACATGGCGTTACAGAGTAGAT | ||
| PDCoV M | F: GACCACATGGCTCCAATTCT | 99 |
| R: TGGCGGATTTCTGACTGATATG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!