Rnaiso plus reagent
RNAiso Plus Reagent is a complete solution for the isolation of high-quality total RNA from a variety of sample types, including cells, tissues, and body fluids. It is designed to efficiently and effectively extract RNA while maintaining its integrity and purity.
Lab products found in correlation
9 protocols using rnaiso plus reagent
Quantifying Gene Expression in NSCLC
Quantifying TGEV-induced gene expression
Gene | Accession number | Sequence (5′–3′) | Size (bp) | Concentration |
---|---|---|---|---|
β-Actin | XM_003124280.2 | F: CTCTTCCAGCCCTCCTTCC | 97 | 0.5 µM |
R: GGTCCTTGCGGATGTCG | ||||
UBXN1 | XM_003353824.1 | F: TTGGAGCTTGTGGCCCAGAA | 139 | |
R: GGCGCATTTCGTCTTCCTGG | ||||
TGEV-N | NC_038861.1 | F: TTCAACCCCATAACCCTCCAACAA | 136 | |
R: GGCCCTTCACCATGCGATAGC |
Validating Differentially Expressed Genes
Quantification of NRF2, HO-1, and ACTB Expression
NRF2, HO-1, and ACTB mRNA levels were measured using qRT-PCR. First, total RNA was extracted using the RNAiso Plus Reagent (Invitrogen, Carlsbad, CA, USA). Thereafter, reverse transcription was performed using the PrimeScript RT-PCR Kit (Takara Bio, Japan). qRT-PCR was performed on an Mx3000p real-time system (Stratagene, USA) using SYBR Premix Ex Taq (Yeasen, Shanghai, China). Amplification was initiated at 95°C for 30 s as the first step, followed by 40 successive cycles of 95°C for 5 s and 60°C for 20 s. Primers from Takara Bio are listed in Supplementary Table
Quantitative Analysis of RNA Levels
RNA Extraction and RT-qPCR Analysis
Liver RNA Extraction and qRT-PCR Analysis
Quantifying miRNA Expression in Adipose Tissue
RNA Extraction and Characterization
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!