Total cellular RNA was extracted using a Universal RNA Extraction Kit (Takara, Beijing, China) according to the manufacturer’s instructions. The mRNA was reverse-transcribed using a PrimeScript IV 1st strand cDNA Synthesis Mix (Takara). Then, RT-qPCR of the cDNA was performed using a TB Green Premix Ex Taq™ II FAST qPCR (Takara) on a ViiA7 System (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences used in this study were designed at the NCBI website (https://www.ncbi.nlm.nih.gov/ , accessed on 10 April 2023) and were as follows: SOX2 (forward, 5′-AACTCCATGACCAGCTCGCAGA-3′ and reverse, 5′-GGACTTGACCACCGAACCCAT-3′), NANOG (forward, 5′-TGGCTCTGTTTTGCTATATCCC-3′ and reverse, 5′-CATTACGATGCAGCAAATACGAGA-3′), OCT4 (forward, 5′-TATGCAAAGCAGAAACCCTCGT-3′ and reverse, 5′-TTCTCCAGGTTGCCTCTCACTCG-3′) and GAPDH or actin (forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′).
Tb green premix ex taq 2 fast qpcr
Manufactured by Takara Bio
Sourced in United States, Japan, Switzerland, China
TB Green® Premix Ex Taq™ II FAST qPCR is a pre-mixed reagent for quantitative real-time PCR (qPCR) applications. It contains the necessary components, including TB Green® Dye, Ex Taq™ HS DNA Polymerase, and buffer, for rapid and sensitive detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Primescript 4 1st strand cdna synthesis mix, by Takara Bio (1 mentions)
Viia 7 system, by Thermo Fisher Scientific (1 mentions)
Universal rna extraction kit, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Rna easy fast tissue cell kit, by Tiangen Biotech (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
4 protocols using tb green premix ex taq 2 fast qpcr
1
RT-qPCR Analysis of Pluripotency Genes
2
RT-qPCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol was used to isolate and purify total RNA from cells or tissues. RNA (1 μg) was added for reverse transcription, and complementary DNA (cDNA) was obtained by Avian Myeloblastosis Virus RT. Subsequently, the RT-quantitative PCR (qPCR) reaction system was formulated by mixing cDNA, specific primers, and TB Green® Premix Ex Taq™ II FAST qPCR (Takara, Japan). The PCR amplification protocol involved 3 min denaturation at 95 °C, followed by 40 repetitive cycles (15 s at 95 °C and 45 s at 60 °C). Gene expression ploidy changes relative to the internal reference glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as the internal reference gene to normalize the expression of other target genes. Gene expression was calculated using the 2−ΔΔCt formula, and the results after three biological replicates were counted. The primer sequences used were as follows: lnc-SNAPC5-3:4 (Forward: TCAAGATGTTGGTGCATGT, Reverse: AGCCATTTTTGCAACTACAC); miR-224-3p (Forward: TGATGTGGGTGCTGGTGTC, Reverse: TTGTGTTGGGGCAGTACTG); and GAPDH (Forward: AGAAGGCTGGGGCTCATTTG, Reverse: AGGGGCCATCCACAGTCTTC).
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted by RNA Easy Fast Tissue/Cell Kit (DP451, TIANGEN, China). The first-strand cDNA was then synthesized with PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara, Japan). Quantitative real-time PCR was performed in LightCycler 480 II (Roche, Switzerland) using TB Green® Premix Ex Taq™ II FAST qPCR (CN830A, Takara, Japan). The relative mRNA expression level was calculated by the threshold cycle (Ct) value of each PCR product and normalized with β-actin by using a comparative 2−ΔΔCt method.
4
Quantifying Viral Gene Expression in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 10–20 individuals from each line using TRIzol (ambion, Beijing, China) following the manufacturer’s instructions. RNA was reverse transcribed into cDNA using PrimeScript™ RT reagent Kit (Takara, Beijing, China). Gene expression analysis was performed by qRT-PCR using TB Green® Premix Ex Taq™ II FAST qPCR (Takara, Beijing, China), according to the manufacturer’s protocol in the CFX Connect Real-Time PCR Detection System (Bio-Rad, Beijing, China) through the Bio-Rad Manager ™ Software Version 3.1. Relative mRNA expression levels were normalized to that of Rpl32.
Primers used for qPCR are listed inTable 3 . The primers for galbut virus and reovirus were designed by this study. The primers for galbut virus and La Jolla virus were from Webster C.L [12 (link)], and the primers for DCV were from Chuan Cao [14 (link)]. The primers for hap23sv were obtained from Chi-Wei Tsai [15 (link)].
Primers used for qPCR are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!