The largest database of trusted experimental protocols

17 protocols using ku60019

1

DNA Damage Inducers and Replication Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
(i) DNA damage inducer and PI3KK inhibitors. Hydroxyurea (HU; #127-07-1; MilliporeSigma) was prepared as a stock solution at 200 mM, according to manufacturer’s instructions. PI3KK inhibitors, KU60019 (#4176; Tocris Bioscience), AZ20 (#S7050; Selleckchem), and NU7441 (#3712; Tocris Bioscience), were dissolved in DMSO at 10 mM. They were applied to cell cultures at 2 days prior to infection at the final concentrations, as we previously reported: HU at 5 mM, KU60019 at 5 μM, AZ20 at 3 μM, and NU7441 at 1 μM (31 (link), 32 (link), 80 (link)).
(ii) In vitro DNA replication inhibitors. We used HAMNO (#S0148, Selleckchem), T2AA (#21921, Cayman Chemical), aphidicolin (#14007, Cayman Chemical), MK886 (#1311, Tocris Bioscience), and PNR7-02 (#2965, Axon Medchem). Stock solutions were prepared in DMSO at 10 mM. The inhibitors were directly added into the reaction of in vitro replication assays at a final concentration of 100 μM for HAMNO, 1 μM for T2AA, 10 μg/μL for aphidicolin, 200 μM for MK886, and 20 μM for PNR7-02 as previously recommended (44 (link)– (link)48 (link)).
+ Open protocol
+ Expand
2

Radiation and Mitomycin C Sensitization

Check if the same lab product or an alternative is used in the 5 most similar protocols
To inhibit ATM and/or DNA-PK, cells were incubated with 5 μM KU60019 (Tocris Bioscience, Bristol, UK) and/or 5 μM NU7026 (Sigma, St. Louis, MO), respectively, in regular growth medium 5 h prior to radiation exposure or MMC treatment. Following treatment, medium was exchanged and fresh inhibitor was added for post-treatment incubation times, as indicated.
+ Open protocol
+ Expand
3

Characterizing Cisplatin-Resistant Ovarian Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
OVCA429 cells were isolated from a patient with late stage, cisplatin-resistant ovarian carcinoma. OVCA429/pCEG cells carrying a green fluorescence protein empty vector and OVCA429/NICD3 cells constitutively expressing green fluorescence protein tagged with NICD3 were sorted by a fluorescence-activated cell sorter and maintained in RPMI 1640 medium (Mediatech Inc, Herndon, VA) supplemented with 10% heat-inactivated fetal bovine serum and 100 U/mL penicillin and streptomycin at 37°C in a 5% CO2 incubator [34] (link). N-acetyl cysteine (NAC) and MSeA (Sigma-Aldrich, St. Louis, MO) were dissolved in phosphate-buffered saline. NAC is an antioxidant that mainly abolishes hydrogen peroxide. Carboplatin (Enzo Life Sciences, Farmingdale, NY) was dissolved in water. KU 60019 and NU 7026 (Tocris, Ellisville, MO) were dissolved in dimethyl sulfoxide, and were ATP-competitive, selective chemical inhibitors of the kinase activity of ATM and DNA-PKcs[35] (link), respectively.
+ Open protocol
+ Expand
4

Stock Solution Preparation for Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stock solutions of NVP-BEZ235, RAD001, NVP-BKM120 and GSK2334470 (Selleckchem, Munich, Germany), MK-2206 and INK128 (Active Biochem, Bonn, Germany), PIK-90 (Merck Chemicals GmbH, Darmstadt, Germany), NU7441 and KU60019 (Tocris Bioscience, Bristol, United Kingdom) were prepared in DMSO. Working concentrations were freshly prepared in medium with control corresponding to highest DMSO concentration.
+ Open protocol
+ Expand
5

Modulating DNA Damage Response Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549. This oligo was a gift from M. Huen [School of Biomedical Sciences, University of Hong Kong (40 (link))], and siATM-2 (used at 60 nM in U-2 OS; #sc-29761, Santa Cruz Biotechnology). Dharmacon On-Target plus siControl (#D-001810-01) was used as a nontargeting siRNA control. siRNA transfections were performed in U-2 OS cells using HiPerFect (Qiagen), and in all other cell lines using Lipofectamine (Thermo Fisher Scientific) according to the manufacturer’s instructions. Experiments were conducted after 48 hours of gene silencing.
+ Open protocol
+ Expand
6

Cell Viability Assay with Kinase Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells, in logarithmic growth, were treated with a titration series of 10 to 0.01 μM ATM inhibitor (ATMi) (KU 60019, Tocris, Bristol, UK), CHK1 inhibitor (CHK1i) (PF-477736, Merck, Molsheim, France), CHK1/2 inhibitor (CHK1/2i) (AZD-7762, Merck, Molsheim, France), Wee1 (Wee1i) (Adavosertib, MedChemTronica, Stockholm, Sweden), or p21 (p21i) (UC2288, Merck, Molsheim, France) diluted in dimethyl sulfoxide (DMSO). After 72 h a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was performed where 20 μL CellTiter 96® AQueous One Solution Assay (Promega, Stockholm, Sweden) was added per 100 μL media. The plates were then incubated for 3 h and analysed in the microplate reader FLUOstar Omega (BMG LABTECH, Ortenberg, Germany). The absorbance at 490 nm and 690 nm was measured to assess the cell viability post-treatment. Each treatment was completed in triplicates. DMSO was used as a negative control.
+ Open protocol
+ Expand
7

Apoptosis Pathway Inhibitors Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following inhibitors were used: Z-vad FMK (Promega, 100 μM), Q-VD-OPh (Sigma, 20 μM), PV-1019 (Merck-Millipore,10 μM), CHK2 inhibitor II (Merck-Millipore,10 μM), NU-7441 (Adooq, 20 μM), KU60019 (Tocris, 10 μM). All inhibitors were added to cells prior to nucleofection or irradiation and maintained in the growth medium for the experiment duration.
+ Open protocol
+ Expand
8

CIN612 Cell Treatment and Protein Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
CIN612 cells were treated with or without ATM-kinase inhibitor KU-60019 (10uM, Tocris, Bristol, UK, Cat. #4176) or Caffeine (100mM Stock) (Sigma, Cat. # C0750) or their respective vehicle (DMSO, PBS) in E-medium supplemented with mouse epidermal growth factor (EGF) for the indicated times as previously described [26 (link)],[51 (link)]. The cells were subsequently harvested for protein.
+ Open protocol
+ Expand
9

Oxidative Stress Modulation in Primary HFMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to treatment, primary HFMs were incubated for 24 h in ‘starved’ 2:1 melanocyte media (2:1 melanocyte media minus 1% FBS and BPE). All treatments were carried out in starved 2:1 melanocyte media for the duration of experiments. Pro-oxidants: fresh hydrogen peroxide (Sigma, UK) solution was prepared as a 10 mM stock solution immediately before use then diluted to the required concentration. Menadione (Sigma, UK) was dissolved in DMSO to 100 mM then diluted to 100 µM in media immediately prior to use. Antioxidants: Vitamin E and Quercetin (VitE/Q; Sigma, UK) were dissolved in water (1 mM) and DMSO (10 mM) respectively before combining to a final concentration of 10 µM (Vitamin E) and 1 µM (Quercetin) in media. Cells were pre-incubated with VitE/Q for 1 h prior to ROS induction. The ATM specific kinase inhibitor KU60019 (Tocris, UK) was dissolved in DMSO to 100 mM then diluted to 5 µM directly into media. Cells were pre-incubated in KU60019 for 1 h prior to ROS induction.
+ Open protocol
+ Expand
10

Inhibiting Mre11 and ATM for DNA Damage Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mirin and KU-60019 were both purchased from Tocris, Bristol, UK. Mirin is a small-molecule inhibitor that blocks the 3ʹ and 5ʹ exonuclease activity associated with Mre11 and prevents ATM activation in response to double-strand breaks (Dupre et al., 2008 (link); Stivers, 2008 (link); Garner et al., 2009 (link)). KU-60019 is a potent ATM kinase inhibitor and has been used to inhibit migration and invasion of human glioma cells in vitro (Golding et al., 2009 (link)).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!