Mmessenger mmachine t7 kit

Site directed mutagenesis of the selectivity filter was done using GeneArt Site Directed Mutagenesis kit (Invitrogen) following the manufacturer protocol. Primers were designed to replace residue 313 (Y) for alanine (Y313A) (forward primer 5′ ACGATTTCAACGGTTGGCGCGGGAGATATTATTCC 3′ and reverse primer 5′ CACCACTGCTAAAGTTGCCAACCGCGCCCTCTATA 3′) using the ORF of TcCAKC cloned into TOPO-Blunt II as template and mutations were verified by sequencing. For expression in Xenopus laevis oocytes, TOPO-Blunt II vector containing the ORFs for TcCAKC or TcCAKC Y313A was purified and linearized with AseI. Coding RNA (cRNA) was obtained by in vitro transcription with mMessenger mMachine T7 kit following the manufacturer's protocol (Ambion). The cRNA length and polyadenylation was verified by non-denaturing gel analysis. Injection of 20 ng (20–40 nL) of the cRNA into chemically defolliculated oocytes (EcoCyte Bioscience) was done using the Nano-Inject II system as previously reported (Jimenez and Docampo, 2015 (link)). Oocytes were maintained in Barth's solution (88 mM NaCl, 1 mM KCl, 0.33 mM Ca(NO₃)₂, 0.41 mM CaCl₂, 0.82 mM MgSO₄, 2.4 mM NaHCO₃, 5 mM HEPES, 0.1 mg/mL penicillin/streptomycin) at 18°C with daily changes of the solution. Recordings were done at 72 h post injection. Oocytes injected with RNase free DEPC water were used as controls.

Genome-length and reporting viral RNAs were prepared from the BamHI-linearized cDNA plasmids through in vitro transcription using mMESSENGER mMACHINE T7 Kit (Ambion, Austin, TX, USA). The RNAs were transfected into BHK-21 cells with DMRIE-C (Invitrogen). After transfection, supernatants were collected at different time points. The culture medium containing viruses were aliquoted and stored at −80 °C for the next experiments.