Total RNA was harvested using an RNeasy Mini kit (Qiagen, Valencia, CA). Reverse transcription was done with a SuperScript First Strand Synthesis System (Invitrogen). RT-PCR was performed with QuantiTech SYBR Green PCR kit (Qiagen) in Rotor-Gene Real-Time DNA amplification system (Corbett Research, New South Wales, Australia) using the COX-2 primers: forward: 5′-AGAAGGAAATGGCTGCAGAA-3′, reverse: 3′-GCTCGGCTTCCAGTATTGAG-5′; Atf4 primers: forward: 5′-TCGATGCTCTGTTTCGAATG-3′, reverse: 3′-GGCAACCTGGTCGACTTTTA-5′. The expression levels of the genes of interest (GOI) were analyzed with the software from Qiagen. For each GOI, a standard curve was established and a value of each treatment group was obtained. Similarly, a standard curve was established for β-actin and its value in each group was calculated. RT-PCR was done in quadruplicate and each GOI value was normalized by β-actin values. The mean and SD were generated with software from these normalized values.
Quantitech sybr green pcr kit
Manufactured by Qiagen
Sourced in United Kingdom, United States
The QuantiTech SYBR Green PCR kit is a reagent kit designed for the quantitative real-time PCR (qPCR) analysis of DNA or cDNA samples. The kit contains all the necessary components, including SYBR Green, a fluorescent dye that binds to double-stranded DNA, enabling the detection and quantification of target sequences during the PCR amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (7 mentions)
Lightcycler 1, by Roche (7 mentions)
Superscript 2 reverse transcriptase enzyme, by Thermo Fisher Scientific (6 mentions)
Reverse transcription system, by Promega (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Lightcycler 1, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Rotor gene real time dna amplification system, by Qiagen (1 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Mygenie 96 thermal block, by Bioneer (1 mentions)
Exicycler 96 system, by Bioneer (1 mentions)
Rotor gene q instrument, by Qiagen (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
Maxwell 16 lev simplyrna tissue kit, by Promega (1 mentions)
Quantitech primer assay, by Qiagen (1 mentions)
Qbase software, by CellCarta (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
23 protocols using quantitech sybr green pcr kit
1
RT-PCR Analysis of COX-2 and Atf4 Expression
2
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were isolated using RNeasy mini kit (QIAGEN). cDNAs were synthesized from the purified RNAs using Reverse Transcription System (Promega). Quantitative-PCR was performed using QuantiTech SYBR Green PCR kit (QIAGEN). Signals were analyzed using the comparative CT method, and ACTB gene was used as an internal control. Primer sequences are listed in Table 2 .
3
Measuring Interferon Response in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RAW264.7 or HEK293T cells were treated with DMEM supplemented with media alone (negative control), DMEM with 1000 units/ml rmIFN-β or rhIFN-β (positive control), or DMEM with 1.0 μg/ml CP and the cells were harvested at 0, 3, 6, 12, and 24 hpt. The total RNA isolation, cDNA synthesis, and visualization of band intensity after PCR were as previously described. Additionally, different cDNA levels from HEK293T cells were measured by quantitative RT- PCR (qRT-PCR) using a QuantiTech SYBR Green PCR kit (Qiagen, Seoul, Korea) on a Mygenie96 thermal block (Bioneer, Daejeon, Korea). The PCR primers are listed in Tables 3 and 4 .
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from NP cells using TRIzol reagent (Invitrogen, Waltham, MA, USA). First-strand cDNA was synthesized using the SuperScript system (Invitrogen, Waltham, MA, USA). PCR amplification conditions were as follows: denaturation at 94 °C for 20 s, annealing at 55 °C for 30 s, and extension at 72 °C for all genes. PCR reactions were performed using the QuantiTech SYBR Green PCR kit (Qiagen, Valencia, CA, USA) and an Exicycler 96 system (Bioneer, Daejeon, Korea). Specific primers for the genes examined were based on their PrimerBank sequences and are listed in Table 1 .
5
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mature miRNAs were expressed using Rotor-Gene® Q instrument with software 2.1.0.9 and quantitative RT-PCR (RT-qPCR) with QuantiTech SYBR Green PCR Kit (Qiagen). RT-PCR was performed in duplicate after optimization, including minus reverse transcription controls to assess any DNA and nontemplate controls for ensuring the lack of background signal. The RT-PCR reaction was set up with mild modifications of manufacturer’s instructions as follows: 5 µL of 2 × QuantiTect SYBR Green PCR Master Mix, 1 µL of 10 × miScript Universal Primer, 1 µL of 10 × primer assay, and 1 µL of RNase-free water. Thirteen miRNAs covering a variety of miRNA sequence features (Table 1 ), including Ce miR-39, were selected, and SNORD61, SNORD68, and SNORD95 were used as housekeeping genes. Shortly after the hot start Taq polymerase activation at 95°C for 10 minutes, reaction was carried out with 40 cycles of 95°C for 15 seconds, 55°C for 30 seconds, and 72°C for 15 seconds, followed by melting reaction ramps from 55°C–95°C at the acquisition of Melt A on Green. For TP53 mRNA expression, forward and reverse primers 5’-CGACAGAGCGAGATTCCATCTCAA-3’ and 5’-GCCCCAATTGCAGGTAAAACAGTC-3’ were used, respectively.
6
Quantifying Gene Expression Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of individual protein-coding gene transcripts was performed according to previous techniques [16] . Brie y, one microgram total RNA was used to generate cDNA by reverse transcription using Superscript II Reverse Transcriptase enzyme (Invitrogen). Quantitative real-time PCR was performed using a LightCycler 1.5 (Roche Diagnostics) in combination with QuantiTech SYBR Green PCR kit (Qiagen Ltd) as per manufacturer's protocol and 1.25 μM of primer pair used Data were analyzed by LightCycler 1.5 software; data normalized to expression of β-Actin and represented at RQ values. Speci c primers for each gene assayed were purchased from Sigma, and sequences used were as follows: β-Actin (Forward (F): gggtgtgatggtgggaatgg, Reverse: ggttggccttagggttcagg); Gfap (F: tatgaggaggaagttcgag, R: tgtctcttgcatgttactgg); IL1β (F: tgaagttgacggaccccaaa, R: agcttctccacagccacaat); P2x7 (F: ttggcaagatgtttctcgtg, R: actggcaggtgtgttccata);; Tnfα (F: ctcttcaagggacaaggctg, R: cggactccgcaaagtctaag); and Il6 (F: ctcagagtgtgggcgaacaa, R: actaactggaaggcttgccc).
7
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of individual protein-coding gene transcripts was performed according to previous techniques [16 (link)]. Briefly, one microgram total RNA was used to generate cDNA by reverse transcription using Superscript II Reverse Transcriptase enzyme (Invitrogen). Quantitative real-time PCR was performed using a LightCycler 1.5 (Roche Diagnostics) in combination with QuantiTech SYBR Green PCR kit (Qiagen Ltd) as per manufacturer’s protocol and 1.25 μM of primer pair used Data were analyzed by LightCycler 1.5 software; data normalized to expression of β-Actin and represented at RQ values. Specific primers for each gene assayed were purchased from Sigma, and sequences used were as follows: β-Actin (Forward (F): gggtgtgatggtgggaatgg, Reverse: ggttggccttagggttcagg); Gfap (F: tatgaggaggaagttcgag, R: tgtctcttgcatgttactgg); IL1β (F: tgaagttgacggaccccaaa, R: agcttctccacagccacaat); P2x7 (F: ttggcaagatgtttctcgtg, R: actggcaggtgtgttccata);; Tnfα (F: ctcttcaagggacaaggctg, R: cggactccgcaaagtctaag); and Il6 (F: ctcagagtgtgggcgaacaa, R: actaactggaaggcttgccc).
8
Quantification of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nine miRNAs covering a variety of miRNA sequences were selected, and mature miRNA expression was determined via quantitative real-time polymerase chain reaction (RT-qPCR) with a QuantiTech SYBR Green PCR Kit (Qiagen) on the Rotor-Gene® Q (Qiagen, USA) instrument using the 2.1.0.9 software. RT-PCR was performed twice for each biological cDNA samples after optimization, including negative and non-template controls.
9
Optimized Noggin Expression Analysis
10
RNA Extraction and Quantitative Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using Trizol (Thermofisher Scientific) protocol as described.15 (link), 17 (link) Briefly, 1 μg total RNA was used to generate cDNA by reverse transcription using Superscript II Reverse Transcriptase enzyme (Thermofisher Scientific). Quantitative real-time PCR was performed using a LightCycler 1.5 (Roche Diagnostics, Indianapolis, IN, USA) in combination with the QuantiTech SYBR Green PCR Kit (Qiagen Ltd, Manchester, UK) as per the manufacturers' protocol and 1.25 μM of primer pair was used. Data were analysed by the LightCycler 1.5 software; data were normalized to the expression of β-Actin and represented at RQ values. Primers were designed using the Primer3 software (http://frodo.wi.mit.edu ) and verified by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi ). Primer sequences of noxa were: 5′-TCAGGAAGATCGGAGACAAA-3′ and 5′-TGAGCACACTCGTCCTTCAA-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!