Ndei and xhoi
NdeI and XhoI are type II restriction endonucleases that recognize and cleave specific DNA sequences. NdeI recognizes and cleaves the palindromic DNA sequence 5'-CATATG-3', while XhoI recognizes and cleaves the palindromic DNA sequence 5'-CTCGAG-3'. These enzymes are commonly used in molecular biology applications such as DNA cloning, plasmid construction, and genetic engineering.
Lab products found in correlation
5 protocols using ndei and xhoi
Cloning and Sequencing of Cbeg5 and Fn5 Constructs
Heterologous Expression of Furanoic Acid Decarboxylases
and G. kaustophilus HmfF gene (WP_011229502)
were codon optimized for E. coli and
synthesized (Genscript). The G. kaustophilus HmfF gene was synthesized with NdeI and XhoI restriction sites upstream and downstream of the coding
region, respectively. The gene was excised from the pUC57 plasmid
using NdeI and XhoI (NEB) and purified
using a QIAquick gel extraction kit (Qiagen). The insert was ligated
in to NdeI/XhoI linearized pET30a
(MerckMillipore) using T4 ligase (NEB).
The P.
thermopropionicum HmfF gene was amplified using Phusion
polymerase (NEB) and the primers Ptherm30aF (AAGGAGATATACATATGTCCCACTCCCTGCG)
and Ptherm30aR (GGTGGTGGTGCTCGAGTTCCAGGTAGTCTGCCAG)
(Eurofins), and the PCR product was cloned into pET30a (MerckMillipore)
linearized with NdeI and XhoI (NEB)
using Infusion HD (Clontech) and transformed into E.
coli NEB5α(NEB). The plasmid was transformed
into E. coli BL21(DE3) (NEB) either
on its own or cotransformed with ubiXpET21b as described previously.11 (link)
Constructing Plasmid Co-Expression System
Subcloning Effector Genes for NF-κB Assay
E. coli Agmatinase Codon Optimization
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!