Quasar 570

To visualize lariat RNA species from intron 13 of the TAOK2 gene, Quasar570^®-labeled smRNA-FISH probes were ordered from Stellaris RNA-FISH (LGC Biosearch technologies). smRNA-FISH was performed according to the manufacturer’s instructions. Briefly, 1 × 10⁶ cells were fixed in 3.7% (vol./vol.) formaldehyde and then permeabilized in 70% ethanol at 4°C. For in situ hybridization, permeabilized cells were incubated with 1.25 μM probes in the hybridization buffer (10% formamide, 10% dextran sulfate, 1 mg/mL E. coli RNA, and 0.2 mg/mL BSA in 2X SSC) at 37°C overnight. Afterward, cells were washed sequentially with wash buffer A (10% formamide in 2X SSC), wash buffer B (0.1% triton-x-100 in 2X SSC), wash buffer C (1X SSC with 1 μg/mL DAPI), and 1X PBS. Finally, these cells were plated onto the coverslip and mounted in ProLong^™ Gold Antifade Mountant (Thermo Fisher Scientific). The mounted cells were imaged using Olympus IX81 inverted widefield microscope equipped with Hamamatsu Orca Flash 4.0 camera with 4 megapixels and a 100× 1.45NA oil objective lens. Single RNA molecule counting was done using ImageJ, and statistical analysis was conducted in R.

MDA-LM2 cells were seeded on a coverslip coated with poly-d-lysine (0.1 mg ml⁻¹) and cultured overnight in complete medium. Cells were fixed with 4% (w/v) methanol-free formaldehyde at room temperature for 10 min, followed by quenching with 0.1 M glycine solution at room temperature for 10 min. After several PBS washes, cells were permeabilized with 70% (v/v) ethanol overnight at 4 °C. Cells were then washed with the wash buffer (2× saline-sodium citrate (SSC) and 10% formamide) at room temperature for 5 min, followed by overnight incubation at 37 °C with hybridization buffer (2× SSC, 10% dextran sulfate, 10% formamide) mixed with each probe set at a final concentration of 0.125 µM. The following day, cells were washed twice with the wash buffer at 37 °C for 30 min. After a brief wash with 2× SSC buffer, coverslips were mounted on a SuperFrost Plus glass using ProLong Diamond antifade mountant with 4′,6-diamidino-2-phenylindole. Cells were imaged using the GE OMX-SR microscope in Z-stacks. Deconvolved images were imported into Fiji or ImageJ; the package RS-FISH^{62 (link)} was used to quantify smRNA-FISH spots. Fluorescent DNA probes (Quasar 570 for the NQO1 sense transcript and Quasar 670 for the antisense transcript, respectively) used in this experiment were synthesized by LGC Biosearch Technologies (Supplementary Table 4).

smFISH probes recognizing HBS1L, HBG1, and Camk2a mRNAs were designed via Stellaris Probe Designer. Fluorescent probes labeled with Quasar 570 (Biosearch Technologies) were synthesized. RNA FISH was conducted according to the instructions. Briefly, cells were fixed with RNase-free 4% PFA for 10 min and washed with PBS for twice, followed by permeabilization with 70% ethanol at 4 °C for 1 h. Probes were hybridized to cells in a hybridization buffer at 37 °C for 12 h. After hybridization, cells were mounted in Vectashield mounting medium (Vector Laboratories). Confocal microscopy was conducted using a Zeiss LSM 800 confocal microscope.

To assay RNA localization of GFP reporter constructs, complementary 18–20-nt DNA probes against the ORF of GFP (24 probes) were designed using the Biosearch Technologies Stellaris RNA FISH probe designer tool (https://biosearchtech.com). All probe sequences are provided in Supplementary Table 7. The reverse complement of the X FLAP^{44 (link)} sequence was added to the 5′ end of each probe: CCTCCTAAGTTTCGAGCTGGACTCAGTG. The X FLAP oligo (CACTGAGTCCAGCTCGAAACTTAGGAGG), 5′ and 3′ end-labeled with Quasar 570, was synthesized by Biosearch Technologies. X FLAP was hybridized with the probe set using the following conditions: 2 μl of the probe set (40 pmol in total), 0.5 μl of 100 μM X FLAP, 1 μl of 10× NEB 3 buffer and 6.5 μl of water were mixed and annealed in a thermal cycler as described previously^{44 (link)}: 85 °C for 3 minutes, 65 °C for 3 minutes, 25 °C for 5 minutes and 4 °C hold. Annealed probes were stored at −20 °C.

Active transcription sites were visualized by fluorescence in situ hybridization (FISH) using sets of 48 20-mer oligonucleotides (Stellaris®-probes; LGC Biosearch Technologies, Petaluma, CA, USA). One set was designed to hybridize with intronic sequences of MYH7-pre-mRNA and each oligonucleotide was labeled with one Cy5-like fluorophore (Quasar 670, LGC Biosearch Technologies). The other set was designed to hybridize with exonic sequences of MYH7-mRNA and labeled with a Cy3-like fluorophore (Quasar 570; LGC Biosearch Technologies). Both probe sets were custom made (Stellaris® Probe Designer). Following hybridization, active transcription sites were taken as bright spots inside nuclei of cardiomyocytes showing both fluorescence signals. Further details are described in Supplementary Material.