Total RNA was harvested from cells using Trizol reagent (TAKARA, Dalian, China) and then reverse transcribed to cDNA using the PrimeScriptTM Reverse Transcription reagent kit (TAKARA) according to the manufacturer's instructions. PCR was performed using premix Taq (TAKARA) on a T100 Thermal Cycler PCR System (Bio-Rad Laboratories, Hercules, CA, USA). qPCR was performed using a SYBR Premix Ex Taq (TAKARA) on the StepOnePlus Real-Time PCR System (Applied Biosystems, FosterCity, CA, USA). The PCRs were performed using primers as follows: HSP72, 5′-AGAGCCGAGCCGACAGAG-3′ (forward) and 5′-CACCTTGCCGTGTTGGAA-3′ (reverse); HSP27, 5′-GGACGAGCATGGCTACATCT-3′ (forward) and 5′-GACTGGGATGGTGATCTCGT-3′ (reverse); HER2, 5′-CTGCACCCACTCCTGTGTGGACCTG-3′(forward) and 5′-CTGCCGTCGCTTGATGAGGATC-3′ (reverse); EGFR, 5′-GCCAAGGCACGAGTAACAAGC-3′ (forward) and 5′-AGGGCAATGAGGACATAACC-3′ (reverse); GAPDH, 5′-GGGGAAGGTGAAGGTCGGAGTC-3′ (forward) and 5′-CAAGCTTCCCGTTCTCAGCCTT-3′ (reverse). In qPCR, GAPDH was used as a normalized control.
T100 thermal cycler pcr system
Manufactured by Bio-Rad
Sourced in United States
The T100 Thermal Cycler is a PCR system that enables precise temperature control and cycling for DNA amplification. It features a compact design and a user-friendly interface for effortless operation.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Premix taq, by Takara Bio (1 mentions)
Primescript reverse transcription reagent kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
Toptaq master mix kit, by Qiagen (1 mentions)
Gf 1 total rna extraction kit, by Vivantis Technologies (1 mentions)
Impromii reverse transcriptase system, by Promega (1 mentions)
E z n a stool dna kit, by Omega Bio-Tek (1 mentions)
Hieff ngs dna selection beads, by Yeasen (1 mentions)
Dsdna hs assay kit for qubit, by Yeasen (1 mentions)
Miseq platform, by Illumina (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
7 protocols using t100 thermal cycler pcr system
1
Quantitative Analysis of Heat Shock Proteins
2
STAT3 Signaling Pathway Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HepG2 cells were transiently transfected with Myc-STAT3, wild-type STAT3 or HIES mutant STAT3 as previously described, followed by LPS or IL-6 treatment. Total RNA was extracted with TRIzol (Life Technologies) according to the manufacturer's instructions. Reverse transcription was performed with oligodT primers and reverse transcriptase M-MLV (#D2640A; Takara). Real-time PCR was carried out in a Bio-RAD-IQ5 Multicolor-Real-Time PCR system with SYBR Green PCR Master Mix (TaKaRa #DRR041A). Relative levels of gene expression were determined with β-actin as the control. RT-PCR was carried out using a Bio-Rad T100 Thermal Cycler PCR system with β-actin as the control. The following primers were used for gene amplification:
TNF-α-F, GTCTGGGCAGGTCTACTTT
TNF-α-R, TGGGCTCCGTGTCTCA
PTK6-F, CGGGAGACTGACACGAAGC
PTK6-R, CCAGCGACAAAGGTGAAGG
EP300-F, GCCAGTGTCGGAATGCCAATT
EP300-R, GCTGAGCAGTCTGAGGAGGG
IL-6R-F, CTGGGTGCTCAGGAATCAGG
IL-6R-R, GTTGGCGACGCATAGGG
NTRK2-F, ATGGCTTTCTAGTCTTGTGG
NTRK2-R, GCATACTCGGCTCTTTGA
β-actin-F, ATGCCATCCTGCGTCTG
β-actin-R, ATGCCATCCTGCGTCTG
TNF-α-F, GTCTGGGCAGGTCTACTTT
TNF-α-R, TGGGCTCCGTGTCTCA
PTK6-F, CGGGAGACTGACACGAAGC
PTK6-R, CCAGCGACAAAGGTGAAGG
EP300-F, GCCAGTGTCGGAATGCCAATT
EP300-R, GCTGAGCAGTCTGAGGAGGG
IL-6R-F, CTGGGTGCTCAGGAATCAGG
IL-6R-R, GTTGGCGACGCATAGGG
NTRK2-F, ATGGCTTTCTAGTCTTGTGG
NTRK2-R, GCATACTCGGCTCTTTGA
β-actin-F, ATGCCATCCTGCGTCTG
β-actin-R, ATGCCATCCTGCGTCTG
3
Gene Expression Analysis of Apoptotic Pathways in API-AuNPs-Treated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from api-AuNPs-treated and untreated KKU-M055 cells using GF-1 total RNA extraction kit (Vivantis Technologies, Selangor, Malaysia) according to the manufacturer's instructions. The first strand complementary DNA (cDNA) was synthesized by reverse transcription with oligo d(T) primers using the Improm II™ reverse transcriptase system (Promega). RT-PCR was performed to detect the expression level of apoptotic genes (Bax, Bid, and Caspase 3), pro-survival gene (Bcl-2) and reference gene (Actin), using a Toptaq Master Mix Kit (Qiagen, Hilden, Germany). The PCR reaction of the above genes was carried out in a T100 Thermal Cycler PCR system (Bio-Rad Laboratories, Hercules, CA, USA) using the primer sequences as shown in Table 1 .Table 1
Primer sequences for RT-PCR.
| Genes | Forward primer sequences (5′–3′) | Reverse primer sequences (5′–3′) | Product size (bp) |
|---|---|---|---|
| Bax | CATCCAGGATCGAGCAGG | CATGTCAGCTGCCACTCGG | 208 |
| Bid | CAAGAAGGTGGCCAGTCACAC | GCTCCGTCTACTCTGGAAGC | 199 |
| Caspase 3 | GTTGATGATGACATGGCGTG | GTTGCCACCTTTCGGTTAA | 203 |
| Bcl-2 | GACTTCGCCGAGATGTCCAG | GTTCAGGTACTCAGTCATCCA | 216 |
| Actin | CTCCTCCCTGGAGAAGAGCT | GCAATGCCAGGGTACATGGT | 231 |
4
Bacterial 16S rRNA Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V3-V4 region of the bacterial 16S ribosomal RNA gene from each sample was amplified using the universal bacterial primers F1 and R2 (5’-CCTACGGGNGGCWGCAG-3’and 5’-GACTACHVGGGTATCTAATCC-3’); these primers correspond to positions 341 to 805 in the Escherichia coli 16S rRNA gene. The PCR reactions were run in a T100™ Thermal Cycler PCR system (Bio-Rad Laboratories, Inc., United States) using the following protocol: 3 min of denaturation at 95 °C, followed by 21 0.5-min denaturation cycles at 94 °C, 0.5 min of annealing at 54 °C, and 0.5 min of elongation at 72 °C, with a final 5 min extension at 72 °C.
5
Bacterial DNA Extraction and 16S rRNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the E.Z.N.A.® Stool DNA Kit (Omega Bio-tek, Inc., GA) to extracted bacterial DNA. All the steps followed the manufacturer's instructions.
Using the bacterial universal primer F1 and R2 to amplify the V3-V4 region of the bacterial 16S ribosomal RNA gene (5’- CCTACGGGNGGCWGCAG -3’ and 5’-GACTACHVGGGTATCTAATCC-3’). The PCR reaction was performed in the T100™ Thermal Cycler PCR system (Bio-Rad Laboratories, Inc., USA). Programs were as follows: denaturing at 95 °C for 3 min, then 21 cycles at 94 °C for 0.5 min (denaturation), annealing at 58 °C for 0.5 min, 0.5 min at 72 °C (elongation), and finally extending for 5 min at 72 °C.
Products from different samples were indexed and mixed by using the Misq platform (Illumina Inc., USA) according to the manufacturer's instructions for sequencing.
Using the bacterial universal primer F1 and R2 to amplify the V3-V4 region of the bacterial 16S ribosomal RNA gene (5’- CCTACGGGNGGCWGCAG -3’ and 5’-GACTACHVGGGTATCTAATCC-3’). The PCR reaction was performed in the T100™ Thermal Cycler PCR system (Bio-Rad Laboratories, Inc., USA). Programs were as follows: denaturing at 95 °C for 3 min, then 21 cycles at 94 °C for 0.5 min (denaturation), annealing at 58 °C for 0.5 min, 0.5 min at 72 °C (elongation), and finally extending for 5 min at 72 °C.
Products from different samples were indexed and mixed by using the Misq platform (Illumina Inc., USA) according to the manufacturer's instructions for sequencing.
6
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The forward primer 5′CCTACGGGNGGCWGCAG-3′ and reverse primer 5′GACTACHVGGGTATCTAATCC-3′ targeting the hypervariable V3–V4 region (341F/805R) of the 16S rRNA gene was used for PCR amplification of the extracted DNA. The reaction was performed on a T100Thermal Cycler PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with the following program: 3 min of denaturation at 95°C, followed by 21 cycles of 0.5 min at 94°C (denaturation), 0.5 min at 58°C (annealing), and 0.5 min at 72°C (elongation), with final extension at 72°C for 5 min. PCR products were detected by 1.5% agarose gel electrophoresis. Amplicons were purified using Hieff NGS DNA Selection Beads (YeasenBiotech, Shanghai, China) and quantified using the dsDNA HS Assay Kit for Qubit (Yeasen Biotech, Shanghai, China). According to the measured values, the product was mixed at equal ratios (50 ng) and sent to Shanghai Mobio Biomedical Technology Co. (Shanghai, China) for high-throughput sequencing on the Miseq platform (Illumina, San Diego, CA, USA) according to the standard manufacturer's protocols. The raw read data of all the samples were deposited in the National Center for Biotechnology Information BioProject database (https://www.ncbi.nlm.nih.gov/bioproject/ , PRJNA837028).
7
Repetitive Element Palindromic PCR for Genetic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Repetitive element palindromic PCR (rep-PCR) was carried out using the primers Pot2-1 and Pot2-2 (Supplementary Table S2) as described previously (George et al. 1998) . For each rep-PCR amplification, a 25 μl total reaction volume was used consisting of 1.25 μl (10 μM) of each primer pair, 2 μl (20 to 30 ng) genomic DNA, 2.0 μl 10× ExTaq buffer, 1.5 μl dNTPs (400 mM each), 16.2 μl distilled water, and 0.3 μl ExTaq DNA polymerase (Takara Bio Inc., Japan). The PCR reaction mixture was amplified by an initial denaturation at 95°C for 2.5 min; four cycles of denaturation at 94°C for 1 min, annealing at 62°C for 1 min, and extension at 65°C for 10 min; followed by 26 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 1 min, and extension at 65°C for 10 min, and with a final extension at 65°C for 15 min in a T100 thermal cycler PCR system (Bio-Rad Laboratories, U.S.A.). The genetic pattern generated by rep-PCR was scored based on the presence or absence of a DNA band of a particular size in all tested isolates. Dice's coefficient was used to determine the similarity matrices, and cluster analysis was performed with BioNumerics software (Applied Math Inc, TX, U.S.A.) by using the UPGMA (unweighted pair-group method with arithmetic averages) method. The experiment was repeated three times and resolved consistent genetic patterns in different replicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!