Quant ittm picogreen reagent

After co-incubation for 2 h, the culture medium described in NET formation was prepared for dsDNA determination. 0.1 M CaCl₂ and 50 U/ml micrococcal nuclease (Sigma-Aldrich, USA) were added for 10 min for DNA fragmentation and digestion. Next, 0.5 M ethylenediaminetetraacetic acid (EDTA) was added to stop the reaction. Then, the supernatants were collected and incubated with Quant-iT^TM PicoGreen® reagent (Invitrogen, UK) in a ratio of 1:1 to determine the cell-free DNA, according to the manufacturer’s instructions. After incubation for 5 min in the dark, the DNA mixture was measured at an excitation wavelength of 480 nm and emission wavelength of 530 nm by spectrofluorometer (Varioskan Flash, Thermo fisher scientific, Finland).

Genomic DNA was extracted and purified from faeces (3‐5 g) with the QIAamp DNA stool mini kit (QIAGEN). The resulting DNA was quantified with Quant‐iTTM PicoGreen reagent (Invitrogen). The sequencing of 16S rRNA amplicons (V1‐V3 region) was performed by MiSeq 300PE (Illumina MiSeq System) at Majorbio (Shanghai, China). Primers used in present study was 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 533R (5′‐TTACCGCGGCTGCTGGCAC‐3′). A total of 151 465 sequence reads of faeces were generated from the amplicon library, with an average of 12 624 reads per sample. The sequences were clustered into 850 operational taxonomic units (OTU) in faeces at a similarity level of 97%. Bioinformatics were performed by Mothur and QIIME2.0 software, including quality control of raw data, taxonomic annotation based on the Silva database, taxonomy‐based comparisons at the OTU level, β‐diversity analysis including principal component analysis (PCA) and principal coordinates analysis (PCoA), dissimilarity analyses including analysis of similarity (ANOSIM) and non‐parametric multivariate analysis of variance (Adonis). The sequencing raw data were deposited in Sequence Read Archive (https://www.ncbi.nlm.nih.gov/Traces/sra; Accession nos. SRP285657).