AML1/ETO was PCR amplified using Q5 High-Fidelity Polymerase (New England Biolabs) from a pMSCV-AML1/ETO plasmid (gift from Dr. J. Mulloy). The PCR product was transferred into the EcoRI and AgeI sites of the tetracycline-inducible pLVX-Tet-One vector (Clontech) using In-Fusion cloning (Clontech). A portion of the resulting pLVX-Tet-One vector was then PCR amplified (Forward Primer: 5′- CAGCAGAGATCCAGTTTATCGACTT-3′; Reverse Primer: 5′- TGCAGAATTAATTCCAGGCGGG -3′) and transferred into a plasmid with AAVS1 homology arms (derived from AAVS1-SA-2A-puro-pA donor, Addgene plasmid #22075) using In-Fusion cloning. The inducible, transgene plasmids were then co-transfected into HEK293T cells using Lipofectamine 3000 (Thermo Fisher) along with the gRNA_AAVS1-T2 (Addgene plasmid #41818) and pCas9_GFP (Addgene Plasmid #44719) plasmids. Three days after transfection the resistant cells were selected with puromycin (2 μg/mL). For the BIRC5 gene, the human coding sequence was obtained as GeneArt Gene Synthesis (Invitrogen) and cloned into the EcoRI and BamHI site of the pLVX-Tet-One vector (Clontech) using the In-Fusion HD cloning system (Clontech). This vector was then used to generate lentiviral particles that were used to transduce NIH3T3 cells. After cells were selected with puromycin, doxycycline (1 μg/mL)-inducible BIRC5 mRNA expression was confirmed by quantitative RT-PCR.
Plvx tetone vector
Manufactured by Takara Bio
The PLVX TetOne vector is a lentiviral expression vector designed for inducible gene expression in mammalian cells. It contains a tetracycline-responsive promoter that allows for tight regulation of transgene expression upon the addition of tetracycline or its derivatives.
Automatically generated - may contain errors
Lab products found in correlation
In fusion cloning, by Takara Bio (2 mentions)
In fusion hd cloning system, by Takara Bio (1 mentions)
Grna aavs1 t2, by Addgene (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Geneart gene synthesis, by Thermo Fisher Scientific (1 mentions)
Pcas9 gfp, by Addgene (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
Dmem f12 media, by Merck Group (1 mentions)
Dmem high glucose, by Merck Group (1 mentions)
T rex 293, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Polyfect, by Qiagen (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
5 protocols using plvx tetone vector
1
Conditional Expression of AML1/ETO and BIRC5 in Cell Lines
2
Cell Culture Methods for Stable Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPE hTERT and ARPE-19 cells were grown in DMEM F12 media with 10% FBS (Sigma-Aldrich), 0.05 mg/ml penicillin, 0.05 mg/ml streptomycin, and 4.5 mM glutamine. mIMCD-K2 cells were a gift from B. Stanton (Dartmouth College, Hanover, NH). T-Rex-293 (Invitrogen), IMCD3 Flp-In, and Phoenix A (PhA) cells (Indiana University National Gene Vector Biorepository) were cultured in DMEM high glucose (Sigma-Aldrich; supplemented with 10% FBS, 0.05 mg/ml penicillin, 0.05 mg/ml streptomycin, and 4.5 mM glutamine). Transfection of plasmids was done with Polyfect (QIAGEN). Stable cell lines were generated by retroviral infection or transfection. NIH 3T3 Flp-In cell lines stably expressing Gpr161WT/V158E-LAP (Gpr161 followed by Speptide-PrecissionS-EGFP [LAP5]) were generated by retroviral infection and antibiotic selection (Pal et al., 2016 (link)). IMCD3 Flp-In cells stably and inducibly expressing 6×Myc-tagged TULP3 N terminus (1–183 aa) were generated by lentiviral infection of the pLVX TetOne vector (Takara Bio Inc.) with the insert. In many cases, stable lines were flow sorted and further selected for GFP.
3
Construction of Tetracycline-Inducible Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pLVX.TetOne-2xstrept-eGFP plasmid was a gift from Nevan Krogan73 (link). pLVX.TetOne-IL10RB and pLVX.TetOne-IFNAR2 where cloned using the parental pLVX-TetOne vector (Takara Bio, Inc.) and cDNA encoding human IL10RB or human IFNAR2 (IDT) with the InFusion HD Cloning Kit (Takara Bio, Inc.). Clones were sequence-verified by sanger sequencing (Psomagen). Sequences are provided in Supplementary Table 14 .
4
EGFP-BIM Fusion Vector Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pLVXTet-One vector was purchased from Takara. The coding sequence for EGFP was PCR-amplified and ligated into the MCS using AgeI/BamHI sites. A fusion of EGFP-BIMEL was generated using SOEing PCR and ligated using AgeI/BamHI sites. EGFP-BIMEL was also ligated into pEGFP-C3 for transient transfection.
A gene fragment encoding BIMEL∆BH3 was synthesized by GeneWiz and subcloned into the pLVXTet-One vector described above to make an N-terminal GFP fusion.
A gene fragment encoding BIMEL∆BH3 was synthesized by GeneWiz and subcloned into the pLVXTet-One vector described above to make an N-terminal GFP fusion.
5
Retroviral Constructs and CRISPR Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The retroviral vectors pWZL (hygro), pWZL-E1A (hygro), pWZL-HRas-V12 (neo) (Lowe et al. 1994 (link)), and Ras-IRES-blast and pLEX vectors were a gift from Dr. Laura D. Attardi. The HRas-V12 insert was transferred from pWZL-HRas-V12 (neo) into pWZL (hygro) linearized with BamHI and SalI. Mouse Hjurp cDNA (accession no. NM_198652.2; synthesized by GenScript) and Cenpa cDNA (accession no. NM_007681.2; purchased from Open Biosystems) were cloned into the BamHI and SalI sites of pWZL. C102T and G105A silent mutations were introduced into pWZL-Hjurp, and then the Hjurp-Hygro gene cassette was transferred into the pLVX-TET-One vector (Clontech) using Infusion cloning (Clontech). gRNA sequences targeting GFP (5′- GAGCTGGACGGCGACGTAAA-3′) and Hjurp (#1, 5′-AAGCGGCTGATAGCGAAGGT-3′; and #2, 5′-ACGGGTCGTCCTCAAAGGGC-3′) were cloned into the lentiCRISPR v2 plasmid (Sanjana et al. 2014 (link)). These sequences target the exon 1–intron boundary and exon 2 of Hjurp, respectively (Supplemental Fig. S3C ). LentiCRISPR v2 plasmids containing gRNA sequences against human HJURP (#3, 5′-GGTCGATGCCACGTCAGACC-3′; and #4, 5′-TCCCTCGCACCGCACAGTCC-3′) were obtained from Genescript. siRNA against Cenpa (#1, 5′-CACAGUCGGCGGAGACAAGtt-3′; and #2, 5′-CUCGUGGUGUGGACUUCAAtt-3′) and control siRNA against luciferase (Luc, 5′-UGGACAAUUAUGGACAACA-3′) were obtained from MWG Eurofins.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!