Total RNA was extracted from either in vitro-cultured Th cells or in vivo-generated Tfh and nTfh cells or lung tissues using TriZol reagent (Invitrogen) according to manufacturer's instructions. Oligonucleotide (dT) and Moloney murine leukemia virus (MMLV) reverse transcriptase (Invitrogen) were used to synthesize cDNA. Gene expression of beta-actin (Actb), Il4, Il5, Il13, Gata3 (ref. 34 (link)), Batf, c-Maf15 (link) and Irf4 (ref. 15 (link)) was examined using the iQ SYBR Green real-time PCR kit (Bio-Rad Laboratories, Inc.). The data were normalized to the reference gene beta-actin. The primer pair's sequences are listed in Table 1 .
Iq sybr green real time pcr kit
Manufactured by Bio-Rad
Sourced in United States
The IQ™SYBR Green real-time PCR kit is a reagent used for quantitative real-time PCR (qPCR) analysis. It contains the SYBR Green I fluorescent dye, which binds to double-stranded DNA and emits a fluorescent signal upon excitation. The kit enables the detection and quantification of target DNA sequences in real-time during the PCR amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Icycler optical system, by Bio-Rad (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Superscript reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Oligo dt primer, by Thermo Fisher Scientific (3 mentions)
Magnify chromatin immunoprecipitation system, by Thermo Fisher Scientific (2 mentions)
Anti rorγt, by Thermo Fisher Scientific (2 mentions)
Bioruptor plus, by Diagenode (2 mentions)
Protein a g dynabeads, by Thermo Fisher Scientific (2 mentions)
Oligonucleotide, by Thermo Fisher Scientific (1 mentions)
Smar1, by Fortis Life Sciences (1 mentions)
β actin, by Santa Cruz Biotechnology (1 mentions)
Smad1 2 3, by Santa Cruz Biotechnology (1 mentions)
P stat3, by Santa Cruz Biotechnology (1 mentions)
Geneamp pcr system 2400, by Thermo Fisher Scientific (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Total rna mini kit, by Geneaid (1 mentions)
10 protocols using iq sybr green real time pcr kit
1
Gene Expression Analysis of Th Cell Subsets
2
Chromatin Immunoprecipitation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed with the MAGnify™ Chromatin Immunoprecipitation System (Life Technologies). Briefly, naive CD4 T cells were cultured under cTH17-skewing conditions in the presence or absence of 10 μM DMXAA for 72 h. 4.5 × 106 cells were cross-linked with 1% formaldehyde for 10 min at room temperature and quenched with 0.125 M glycine. Samples were lysed and chromatin sheared using a Bioruptor Plus (Diagenode) sonication system to obtain 200- to 500-bp fragments (14 cycles, 30″ on, 30″ off, high setting). Chromatin-protein complexes were immunoprecipitated with either 5 μg anti-Rorγt (Invitrogen) or IgG control that were pre-bound to Protein A/G Dynabeads™ (Invitrogen) overnight on a rotator at 4°C. Afterward, cross-linking was reversed, and DNA was eluted and purified according to the supplier’s instructions. Purified DNA was used for qPCR analysis with iQ™SYBR Green real-time PCR kit (Bio-Rad) using primers encompassing the Il17a CNS2 enhancer region, listed in the key resources table . Data were calculated (2−(ΔCT IP − ΔCT control)) and presented as fold enrichment over IgG control.
3
Gene Expression Analysis of Differentiated T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from naïve or differentiated T cells using TriZol reagent (Invitrogen). cDNA was synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen), and gene expression of beta–Actin (Actb), Grail, Il21, Il4, Gata321 (link),33 –34 (link), Il2 (F-GCGCACCCACTTCAAGCTCCA; R-CTGTGGCCTGCTTGGGCAAGT), Il5 (F-CGCTCACCGAGCTCTGTTG; R-CCAATGCATAGCTGGTGATTTTT), Il13 (F-GCTTATTGAGGAGCTGAGCAACA; R-GGCCAGGTCCACACTCCATA) and Stat6 (F-AGTCACTATAAGCCCGAACAG; R-GCCATTCCAAGATCATAAGGT) was examined with a Bio-Rad iCycler Optical System using iQ SYBR green real-time PCR kit (Bio-Rad Laboratories, Inc.). The data were normalized to Beta-Actin gene.
4
Chromatin Immunoprecipitation and qPCR Analysis
5
Quantifying Mouse T-bet and GATA3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was examined with a Bio‐Rad iCycler Optical system with an iQ SYBR Green Real‐Time PCR kit (Bio‐Rad Laboratories, CA). Data were normalized to expression of mouse Hypoxanthine‐guanine phosphoribosyltransferase (HPRT, a reference gene). Primers were mouse T‐bet forward, 5'‐ AACCAGTATCCTGTTCCCAGC ‐3', and reverse, 5'‐ TGTCGCCACTGGAAGGATAG ‐3’; mouse GATA3 forward, 5'‐ CTCCTTTTTGCTCTCCTTTTC ‐3', and reverse, 5'‐ AAGAGATGAGGACTGGAGTG ‐3'. Mouse HPRT, mouse SHN2, and mouse SHN3 primers and probes were from ABI (GenBank accession code Mm00446968_m1, Mm00468908_m1, and Mm00495184_m1).
6
SMAR1 Expression and Signaling Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was examined using a thermocycler (Eppendorf, Hauppauge, New York, NY, USA) with an iQ SYBR Green Real-Time PCR kit (Bio-Rad Laboratories Inc.). Data were normalized to expression of GAPDH (reference gene). Transcripts of SMAR1 forward: 5′-GCATTGAGGCCAAGCTGCAAGCTC-3′, reverse: 5′-CGGAGTTCAGGGTGATGAGTGTGAC-3′, GAPDH forward: 5′-AATTCAACGGCACAGTCAAAGCCGAGAATG-3′, reverse: 5′-GCGGCACGTCAGATCCACGCAGGAC-3′ were amplified by PCR. For immunoblot analysis, 50 µg of protein from whole T cell lysates was resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. After transferring the proteins to polyvinyl difluoride membrane it was probed using SMAD1/2/3, pSTAT3 (Santa Cruz Biotechnology Inc.), SMAR1 (Bethyl Laboratories), and β-actin (Santa Cruz Biotechnology Inc.) antibodies using a standard protocol.
7
Gene Expression Analysis of Differentiated T Cells
8
RT-qPCR Analysis of Transcription Factors
9
Gene Expression Analysis in VSMC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SHR and WKY VSMC total RNAs were extracted with the TRIzol reagent (Invitrogen). Tissue RNA was extracted with a Total RNA Mini Kit (Geneaid, New Taipei, Taiwan). For the qPCR, 0.5–1 μg of total RNA was taken for RT reaction, complementary (c)DNA was synthesized using SuperScript reverse transcriptase under priming of a random hexamer (Invitrogen), and gene expression was examined in a Bio-Rad iCycler optical system using the iQ™ SYBR green real-time PCR kit (Bio-Rad Laboratories). Data were normalized to α-actin reference. Primers used included forward primers Pou2f2: TTCATCCTCCTCCTCCTCCT; Cebpb: GACAAGCTGAGCGACGAGTA; Edn1: ACCACAGACCAAGGGAACAG; and Acta2: CACTTCCACAGAGCCAGACA and reverse primers Pou2f2: CTCCTTCGTCACTCCTGCTC; Cebpb: GACAGCTGCTCCACCTTCTT; Edn1: GGTCTTGATGCTGTTGCTGA; and Acta2: ATGGTGGTTTGGCTGAAGTC. For the RT-PCR, cDNA was synthesized using MMLV reverse transcriptase under priming of a random hexamer (BD Biosciences, San Jose, CA, USA), and the PCR used Taq DNA polymerase (Viogene, Taipei, Taiwan). Primers used included Pou1f1, forward, GATGGCAGGCACTTTAACCCCTTG, and reverse, GCAGATAAGACTTGCCTGTGGTAG. Primers are added to the reaction mixture and subjected to 30 cycles of amplification in a PCR machine (GeneAmp PCR System 2400; Applied Biosystems) at an annealing temperature of 55°C.
10
Quantitative Real-Time PCR of DHHC21
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from T cells using TriZol reagent (Invitrogen). cDNA was synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen) and gene expression was examined with a Bio-Rad iCycler Optical System using iQ™ SYBR green real-time PCR kit (Bio-Rad Laboratories, Inc.).
The data were normalized to 18S. DHHC21: F-GGCTCTTTCTGCAGTTGTGT; R-GGCCGCGATATTTCTTCACA.
The data were normalized to 18S. DHHC21: F-GGCTCTTTCTGCAGTTGTGT; R-GGCCGCGATATTTCTTCACA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!