Scai hf restriction enzyme

Manufactured by New England Biolabs

Sourced in United States

ScaI-HF® Restriction Enzyme is a type II restriction endonuclease that recognizes and cleaves the DNA sequence 'AGTACT' at a specific site. It is a high-fidelity variant of the original ScaI enzyme, providing increased specificity and reduced star activity.

Automatically generated - may contain errors

Lab products found in correlation

Molecular imager fx, by Bio-Rad (1 mentions) α 32p dctp, by PerkinElmer (1 mentions) Hybond xl membrane, by GE Healthcare (1 mentions) Hybond, by Cytiva (1 mentions)

Spelling variants of this product

Restriction enzymes (748 citations) ScaI-HF (16 citations) ScaI restriction enzyme (7 citations)

2 protocols using scai hf restriction enzyme

HIV-1 LTR Fragment Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following sequence from 433 to 633 bp of the HIV-1 LTR was used: CAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC.
The fragment was cloned into a pMA-T vector at the Sfil cloning site by the Life Technologies GeneArt Service (ThermoFisher Scientific). Plasmid DNA was purified from transformed E. coli K12 (dam + dcm + tonA) (Fig. 1a), linearized using a single-cutter ScaI-HF® Restriction Enzyme (New England BioLabs, Ipswich, MA, USA) and purified using a PureLink™ Quick Gel Extraction Kit (Invitrogen/ThermoFisher Scientific, Waltham, MA, USA).

Kibirige C.N., Manak M., King D., Abel B., Hack H., Wooding D., Liu Y., Fernandez N., Dalel J., Kaye S., Imami N., Jagodzinski L, & Gilmour J. (2022). Development of a sensitive, quantitative assay with broad subtype specificity for detection of total HIV-1 nucleic acids in plasma and PBMC. Scientific Reports, 12, 1550.

+ Open protocol

+ Expand

Telomere Length Determination Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was prepared from 2 × 10⁸ cells and digested with ScaI-HF restriction enzyme (New England Biolabs). The digested DNA was resolved on 1.5% agarose gel and blotted onto a Hybond-XL membrane (GE Healthcare), as previously described (39 (link)). After transfer, the membrane was cross-linked with UV and hybridized with ura4 and abo1 probes made with primers listed in Supplementary Table S2 (40 ). ³²P labeling of DNA probes was performed by random priming using Klenow fragment lacking exonuclease activity (New England Biolabs), in presence of [α-³²P]dCTP (Perkin Elmer) and hybridizations were performed in Church buffer at 60°C for ura4 and abo1 probes (40 ). Radioactive signals were detected using a Biorad molecular imager FX. The telomere length was determined using the BioRad software.

Vaurs M., Audry J., Runge K.W., Géli V, & Coulon S. (2022). A proto-telomere is elongated by telomerase in a shelterin-dependent manner in quiescent fission yeast cells. Nucleic Acids Research, 50(20), 11682-11695.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!