RNA was extracted from microglia cells with the Quick RNA MiniPrep (Zymo Research, Freiburg, DE) and retrotranscribed with iScript Reverse Transcription Supermix for Real-time PCR (RT-PCR) (Bio-Rad, Hercules, CA, USA). RT-PCR was carried out using Sybr Green (Bio-Rad) according to the manufacturer’s instructions. The PCR protocol consisted of 40 cycles of denaturation at 95°C for 30 s and annealing/extension at 60°C for 30 s. For quantification, the comparative Threshold Cycle (Ct) method was used. The Ct values from each gene were normalized to the Ct value of GAPDH in the same RNA samples. Relative quantification was performed using the 2−ΔΔCt method92 (link) and expressed as fold change in arbitrary values.
Iscript reverse transcription supermix for real time pcr rt pcr
Manufactured by Bio-Rad
Sourced in United States
The IScript Reverse Transcription Supermix for Real-time PCR (RT-PCR) is a reagent used for the reverse transcription of RNA into cDNA, which can then be used in real-time PCR applications. The supermix contains all the necessary components for the reverse transcription reaction, including the reverse transcriptase enzyme, dNTPs, and buffer.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using iscript reverse transcription supermix for real time pcr rt pcr
1
Quantitative Analysis of Microglia Gene Expression
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hippocampal tissue with the Quick RNA MiniPrep (Zymo Research, Freiburg, DE) and retrotranscribed with iScript Reverse Transcription Supermix for Real‐time PCR (RT‐PCR) (Bio‐Rad, Hercules, CA). RT‐PCR was carried out using Syber Green (Biorad) according to the manufacturer's instructions. The PCR protocol consisted of 40 cycles of denaturation at 95°C for 30 s and annealing/extension at 60°C for 30 s. For quantification analysis the comparative Threshold Cycle (Ct) method was used. The Ct values from each gene were normalized to the Ct value of GAPDH in the same RNA samples. Relative quantification was performed using the 2 − ∆∆Ct method (Schmittgen & Livak, 2008 (link)) and expressed as fold change in arbitrary values. Primer sequences targeted against GAPDH forw: TCG TCC CGTAGACAAAATGG, GAPDH rev: TTGAGGTCAATGAAGGGGTC; CD44 forw ACCTTGGCCACCACTCCTAA; CD44 rev GCAGTAGGCTGAAGGGTTGT; GFAP forw AGAAAGGTTGAATCGCTGGA; GFAP rev CGGCGATAGTCGTTAGCTTC; Kir 4.1 forw ATCAGAGCAGCCACTTCACC; Kir 4.1 rev GGCTCTCTGTCTGAGTCGTC; LAMP1 forw ACTGGTAACAACGGAACCTG: LAMP1 rev ACACATTGGGGTTAGGAACA; LAMP2 forw CTAGGAGCCGTTCAGTCCAA; LAMP2 rev CTTGCAGGTGAATACCCCAA.
3
Quantifying Hippocampal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hippocampal tissue with the Quick RNA MiniPrep (Zymo Research, Freiburg, DE) and retro transcribed with iScript Reverse Transcription Supermix for Real-time PCR (RT-PCR) (Bio-Rad, Hercules, CA, USA). RT-PCR was carried out using Sybr Green (Biorad) according to the manufacturer’s instructions. The PCR protocol consisted of 40 cycles of denaturation at 95 °C for 30 s and annealing/extension at 60 °C for 30 s. For quantification analysis the comparative Threshold Cycle (Ct) method was used. The Ct values from each gene were normalized to the Ct value of GAPDH in the same RNA samples. Relative quantification was performed using the 2−∆∆Ct method (Schmittgen and Livak, 2008) and expressed as fold change in arbitrary values. Primer sequences targeted against GAPDH forw: TCG TCC CGT AGA CAA AAT GG, GAPDH rew: TTG AGG TCA ATG AAG GGG TC; P2Y12 forw CCT GTC GTC AGA GAC TAC AAG, P2Y12 rew GGA TTT ACT GCG GAT CTG AAA G; P2Y6 forw ATC AGC TTC CTG CCT TTC C, P2Y6 rew CTG TGA GCC TCT GTA AGA GAG ATC G.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!