Q5 high fidelity taq polymerase

The amino acid sequence of TDIF (HEVPSGPNPISN) from Arabidopsis was used to identify orthologous sequences in H. glycines by performing a TBLASTN search to a recently assembled transcriptome representing early parasitic life stages and filtering at an e-value cutoff of 1000. These candidate transcripts were then translated into protein and run through SignalP for prediction of N-terminal signal peptides, following which those candidates possessing a signal peptide were retained. Finally, the position of the CLE-domain identified was examined and any candidates lacking a C-terminal CLE domain were eliminated. Primers (HgCLEBF1: 5’ AGGAATAATTAACGGATTAAATCAA 3’ and HgCLEBR2: 5’ GAAGGAAAAGCATGAATAAACG 3’) were designed based on the UTR region sequences of SCN B-type CLEs to identify potential orthologous sequences from beet cyst nematode H. schachtii. Isolation of parasitic life stages, RNA extraction and first strand cDNA generation were conducted as previously described [14 (link), 52 (link)]. PCR reactions were conducted with Q5 high fidelity Taq polymerase (New England Biolabs). PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced. HgCLEB1, HsCLEB1 and HsCLEB2 cDNA sequences were deposited in Genbank under accession numbers KY271087, KY124382 and KY124383, respectively.

Restriction enzymes were purchased from New England Biolabs; T4 DNA ligase and Taq DNA polymerase were from Invitrogen; Velocity proof-reading DNA polymerase was from Bioline; Q5 high fidelity Taq polymerase was from NEB. PCR amplification of DNA was achieved using the primers (AltaBioscience, University of Birmingham, UK; or Sigma Aldrich) listed in S3 Table. Reactions were cycled in a SensoQuest Lab Cycler following standard procedures [57 ]. PCR products were purified using the Illustra GFX^TM PCR DNA and Gel Band Purification Kit (GE^TM Healthcare). Small-scale plasmid DNA preparations were performed using the AccuPrep Plasmid MiniPrep DNA Extraction Kit (Bioneer) adapted from the alkaline lysis method of Birnboim and Doly [58 (link)]. DNA sequencing reactions were prepared and run on an ABI 3730 DNA analyser (Functional Genomics Facility, University of Birmingham, U.K.) following the chain termination method [59 ].

Sanger sequencing of the atm allele was performed on individual F1 embryos or on tail tissue from adult zebrafish by extracting DNA using heat denaturation in 50 mM NaOH (95 °C for 20 min). PCR by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) amplified a 500 bp fragment spanning the site of the mutation (Supplementary Table S1). An amount of 5 μL of the PCR products were purified by ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific, Waltham, MA, USA) following manufacturer’s instruction, were sequenced using Sanger Sequencing Kit (Applied Biosystem, Waltham, MA, USA) following manufacturer’s instruction and sequenced using SeqStudio Genetic Analyzer (Applied Biosystems). Results were analyzed using Synthego (https://ice.synthego.com/#/, accessed on 20 March 2023) to identify mutant alleles. atm^−/− adults were genotyped using Sanger sequencing prior to all experiments with their offspring.