Total RNA was extracted from the lungs or cells using Trizol reagent (TaKaRa, Dalian, China) according to manufacturer’s instructions, and first-strand cDNAs was obtained from the extracted RNA by using the First-Strand Synthesis Kit (Roche, San Francisco, CA, USA). qPCR primers are listed in Table 2 . qPCR was carried out using the Universal Master Mix (Roche). The thermocycling conditions were: 94°C for 10 min, 45 cycles of 94°C for 30 s, and 60°C for 1 min. The relative expression levels of target genes were normalized against β-actin and calculated using the comparative 2−ΔΔCt method.
Universal master mix
Manufactured by Roche
Universal Master mix is a pre-formulated solution containing all the necessary components for performing polymerase chain reaction (PCR) experiments. It includes a thermostable DNA polymerase, dNTPs, buffer, and other essential reagents in a single, ready-to-use mixture.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Mastercycler realplex2 system, by Eppendorf (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Gene specific primers, by Integrated DNA Technologies (3 mentions)
Universal probe library algorithm, by Roche (2 mentions)
Trizol reagent, by Takara Bio (1 mentions)
First strand synthesis kit, by Roche (1 mentions)
Universal probe library probe, by Roche (1 mentions)
Universal probe library system, by Roche (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6 flex machine, by Thermo Fisher Scientific (1 mentions)
Illustra tripleprep kit, by GE Healthcare (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
User bulletin 2, by Thermo Fisher Scientific (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
7 protocols using universal master mix
1
Quantitative Real-Time PCR Analysis
2
Quantitative Real-Time PCR Analysis
3
Quantitative RT-PCR analysis of viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified from Vero cells, primary neurons, and astrocytes using the RNeasy minikit (Qiagen, Hilden, Germany) with a final elution volume of 30 μl, following the manufacturer’s recommendations. RNA was quantified using a Nanodrop spectrophotometer and reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) with random hexamer priming. Gene-specific primer pairs were designed using the antigenome of MV. The primer pairs were used in combination with probes designed using the Universal Probe Library system (Roche) and Universal Master Mix (Roche). All reactions were run on an Applied Biosystems QuantStudio 6 Flex machine and analyzed using the QuantStudio software. Cycling conditions were 50°C for 2 min and 95°C for 10 min, followed by 40 (2-step) cycles of 95°C for 15 s and 60°C for 60 s. Relative quantification to the control (cyclophilin B) was done using the comparative threshold cycle (ΔΔCT) method. A standard curve of RNA from a known amount of PFU was run to determine PFU equivalents. Individual sample PCRs were performed in triplicate. Gene-specific primers (Integrated DNA Technologies, Coralville, IA) used in this study are listed in Table 1 .
4
Quantitative RT-PCR for Viral RNA Analysis
5
Quantitative Real-Time PCR for miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Assay Design Center software (http://lifescience.roche.com/shop/products/universal-probelibrary-system-assay-design ) was used to identify primers and UPL probes (Supplementary Table 2 ). Total RNA (300 ng) was reverse-transcribed with High Capacity cDNA Reverse Transcription Kit (Thermo-Fisher Scientific). MicroRNAs were reverted from 25 ng of total RNA using the specific reverse primer (stem loop RT primers) and the TaqMan Micro-RNA Reverse Transcription Kit (Thermo-Fisher Scientific). Reactions were incubated 30 min at 16°C, followed by pulsed RT [49 (link)]. Real-time PCR was performed using the Universal Mastermix (Roche) and the relative expression, normalized to an endogenous reference GAPDH or RNU44, was determined using the 2−Δct method (User Bulletin #2, Applied Biosystems).
6
Quantitative RT-PCR for Viral Nucleoprotein
7
Copy Number Variation Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Copy number variation (CNV) was performed by reverse transcription quantitative PCR (RT-qPCR) using both the TaqMan technology (STUB1 ID: Hs02061495 cn; COX19 ID: Hs02372251 cn; JAG2 ID: Hs03069093; HES5 ID: Hs02713003 cn; Thermo Fisher Scientific) and the Roche Assay Design Center software to identify primers and relative UPL probes (https://lifescience.roche.com/en it/brands/universal-probe-library.html; KRAS F TGTATGGGCTGTGACATTGC -KRAS R CCACCTGTTCTTCCACCATC, UPL #68; TP53 F TGTTCTTGCAGTTAAGGGTTAGTTT -TP53 R TGAAGTGGGCCCCTACCTA, UPL#05; DLEU2 F ACGTTGTGCAGAAACTTGAGAC -DLEU2 R TCTAAGCAACCTGGATTTCACA, UPL#68). Briefly, 10 ng of DNA was amplified using the Universal Mastermix (Roche, Basel, CH), specific primers, fluorescent probes and the Human TaqMan R Copy Number Reference Assays RNase P as internal standard reference (Thermo Fisher Scientific). Each sample was analyzed in triplicate on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Each well was normalized to RNase P to obtain the Ct (2-[FAM dye Ct -VIC RNAseP dye Ct]). All samples were then normalized to a calibrator (three DNA samples from healthy donors) to determine Ct. Samples were considered to be carrying deletion or amplification if loss/acquisition of genetic material at the corresponding chromosome region was ≥25% compared with the average values of normal controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!