Primers for qpcr

Manufactured by Merck Group

Sourced in Germany

Primers for qPCR are short DNA sequences used to initiate the amplification of specific target sequences during quantitative real-time PCR (qPCR) experiments. They serve as the starting point for DNA synthesis, allowing the detection and quantification of target genes or transcripts.

Automatically generated - may contain errors

Lab products found in correlation

Glutamax, by Thermo Fisher Scientific (2 mentions) Transcriptor first strand cdna kit, by Roche (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Lightcycler 480, by Roche (1 mentions) Nucleospin rna xs kit, by Macherey-Nagel (1 mentions) Phenol red free dmem, by Thermo Fisher Scientific (1 mentions) Accutase, by Thermo Fisher Scientific (1 mentions) Collagenase 1a, by Merck Group (1 mentions) Ascorbic acid, by Merck Group (1 mentions) Bovine serum albumin (bsa), by Merck Group (1 mentions) Reduced glutathione, by Merck Group (1 mentions)

Close spelling variants of this product

QPCR primers

2 protocols using primers for qpcr

Blastema Slice RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blastema slice RNA was extracted using Trizol (Invitrogen) in conjunction with the Nucleospin RNA XS kit (Macherey-Nagel). Samples were processed to generate cDNA using the Transcriptor First Strand cDNA Kit (Roche). Real-time PCR was performed using a LightCycler 480 (Roche) and the resulting data were analyzed using the Pfaffl method [39 (link)]. Sequences for the primers for qPCR (Sigma) were based on primers published previously [40 (link),41 (link)].
GAPDH FWD: GACGCTGGTGCAGGCATTGCC
GAPDH REV: ACCATCAGGTCCACAACACGCTGAC
Prrx1 FWD: GGCGAAAGTTTGCTCTTCGG
Prrx1 REV: GGCGAAACTTTGCTCTTCGG

Lehrberg J, & Gardiner D.M. (2015). Regulation of Axolotl (Ambystoma mexicanum) Limb Blastema Cell Proliferation by Nerves and BMP2 in Organotypic Slice Culture. PLoS ONE, 10(4), e0123186.

+ Open protocol

+ Expand

Chondrocyte Isolation and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phenol red free DMEM, accutase and GlutaMax were products of Gibco (Thermo Fisher Scientific, Dreieich, Germany). Reduced glutathione, collagenase 1A, bovine serum albumin (BSA), ascorbic acid, E2 and primers for qPCR were provided by Sigma-Aldrich (Neustadt, Germany). Other cell culture reagents and additives were purchased from Biochrom (division of Merck Millipore, Berlin, Germany) unless otherwise specified. Reagents used for RT-qPCR were obtained from Thermo Fisher Scientific (Dreieich, Germany).

Palma-Vera S.E., Schoen J, & Chen S. (2017). Periovulatory follicular fluid levels of estradiol trigger inflammatory and DNA damage responses in oviduct epithelial cells. PLoS ONE, 12(2), e0172192.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!