The flexural modulus of PCL, PLA and 50:50 blends was measured under 3-point bending from extruded filaments of 2 mm diameter mounted on a 1 cm support spam. A TA ElectroForce (TA Instruments) mechanical tester equipped with a 45 N load cell and controlled with WinTest DMA 7.1 software was used to deform he samples at a strain rate of 0.01 mm/s. The experiments were run until creep (or until the maximum applicable load was reached). The flexural modulus was calculated from the slope of the linear region of recorded force-displacement curves. The storage and loss moduli and the tangent δ of PCL, PLA and Janus scaffolds were measured from 3D printed single fibers of 400 µm diameter using a TA Q800 dynamic mechanical thermal analyzer. Experiments were run with a thermal sweep from 20–65 °C, a 3 °C temperature ramp, a dynamic strain of 0.5% and fixed frequency of 0.1 Hz from which the storage modulus, loss modulus and tangent δ are reported as mean ± SD, n = 3. Experiments were also run under a frequency sweep of 0.1–100 Hz at a fixed temperature of 37 °C using a strain of 0.5%. All PLA samples broke above 1.6 Hz. n = 3.
Ta electroforce
Manufactured by TA Instruments
The TA ElectroForce is a versatile mechanical testing instrument designed for a wide range of applications. It provides precise control and measurement of force, displacement, and other mechanical properties of various materials and samples.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using ta electroforce
1
Mechanical Properties of PCL, PLA Blends
2
Compressive Mechanical Properties Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forward primer 5 to 3 Reverse primer 5 to 3
GGAACCAAGAAGGCACAGAC CGGGACACCTACTCTCATAC noted down for data analysis. The compressive mechanical properties were measured in the dry state in unconfined and nonequilibrium conditions. Samples for biological studies were measured in PBS before and after cell culture. A TA ElectroForce (TA Instruments) mechanical tester equipped with a 45 N load cell was used for all the measurements. The instrument was controlled with WinTest7 software. Tests were conducted at a strain rate of 0.01 mm/s. The experiments were run until approximately 50% deformation (or until the maximum applicable load was reached).
No pre-load was applied and the initial recorded data corresponding to the compression plate traveling to contact the sample was subtracted prior data analysis. The Young's modulus was calculated from the slope of the engineering strain-stress curve between 0.2% and 1.2% strain. This range was chosen to avoid barreling of the sample and correction for the dimensions of the sample.
GGAACCAAGAAGGCACAGAC CGGGACACCTACTCTCATAC noted down for data analysis. The compressive mechanical properties were measured in the dry state in unconfined and nonequilibrium conditions. Samples for biological studies were measured in PBS before and after cell culture. A TA ElectroForce (TA Instruments) mechanical tester equipped with a 45 N load cell was used for all the measurements. The instrument was controlled with WinTest7 software. Tests were conducted at a strain rate of 0.01 mm/s. The experiments were run until approximately 50% deformation (or until the maximum applicable load was reached).
No pre-load was applied and the initial recorded data corresponding to the compression plate traveling to contact the sample was subtracted prior data analysis. The Young's modulus was calculated from the slope of the engineering strain-stress curve between 0.2% and 1.2% strain. This range was chosen to avoid barreling of the sample and correction for the dimensions of the sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!