RNAs were synthesized by in vitro transcription using T7 RNA polymerase with slight modifications to published procedures (Keane et al., 2015 (link)). RNAs were synthesized by in vitro transcription using T7 RNA polymerase in 10–30 ml reactions, each containing ~8 pmol of annealed DNA template, 2 mM spermidine, 80 mM Tris–HCl (pH 8.5), 2 mM DTT, 20% DMSO, 0.3 mg T7 RNA polymerase, 10–20 mM MgCl2, and 3–6 mM NTPs. Selectively protonated RNA samples were prepared using appropriate combinations of deuterated and fully or partially protonated NTPs. After a three-hour incubation at 37 °C, the reaction was quenched by addition of an EDTA-Urea mixture (250 mM EDTA pH = 8.0, 7 M Urea), boiled for 3 minutes followed by immediate cooling in a bath of ice water. The RNA was then purified by electrophoresis on urea-containing polyacrylamide denaturing gels (SequaGel, National Diagnostics) using FisherBiotech DNA sequencing system at 20W overnight. The gel bands were visualized by UV-shadowing, excised, and eluted using the Elutrap ® electroelution system (Whatman) at 100 V overnight. The eluted RNAs were washed with 2M NaCl and then desalted using 10 kDa MWCO Amicon ® Ultra-4 Centrifugal Filter Device (Millipore). The concentration of each sample was determined by measuring the optical absorbance at 260 nm.
Elutrap electroelution system
Manufactured by Cytiva
Sourced in United Kingdom, Germany
The Elutrap Electroelution System is a laboratory instrument designed to extract and concentrate target biomolecules, such as proteins or nucleic acids, from complex samples. The system uses an electric field to separate and elute the desired molecules from a gel or membrane matrix. The Elutrap provides a gentle and efficient method for recovering biomolecules while maintaining their structural integrity.
Automatically generated - may contain errors
Lab products found in correlation
Whatman, by Cytiva (9 mentions)
Sequagel, by National Diagnostics (4 mentions)
Amicon ultra centrifugal filter device, by Merck Group (3 mentions)
Amicon ultra 4 centrifugal filter device, by Merck Group (2 mentions)
Amicon ultra centrifugal filter unit, by Merck Group (1 mentions)
Plasmid mega kit, by Qiagen (1 mentions)
9 protocols using elutrap electroelution system
1
In Vitro Transcription of Selectively Protonated RNAs
2
In vitro Transcription Template Generation
3
In vitro Transcription of Yeast 5S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sc5S rRNA was prepared via in vitro transcription using T7 RNA polymerase. The DNA oligonucleotides used to construct Sc5S rDNA are described in Supplementary Table S2. The 5S_S1∼6 and 5S_AS1∼6 primers were mixed and annealed after heating at 90ºC for 5 min, followed by a subsequent cool down to 4ºC at 0.1ºC/12 sec. The fragment was cloned into pUC19 via the EcoRI and HindIII sites. The 5S rDNA sequence was confirmed by plasmid DNA sequencing. Double-strand DNA transcription templates were obtained via PCR with 5S_S-1 and 5S_AS-7. In vitro transcription was performed overnight at 37ºC in a solution containing 80 mM HEPES-NaOH pH 8.1, 20 mM MgCl2, 2.04 mM spermine, 20 mM DTT, 40 mM KCl, 1.4 μg/ml BSA, 5 mM NTPs, 20 mM GMP, 2.5 μg/ml transcription template, 0.1 U/ml pyrophosphatase and 0.24 mg/ml T7 RNA polymerase. The reaction mixture was subsequently isopropanol-precipitated, purified by denaturing urea-polyacrylamide gel electrophoresis and extracted with an Elutrap Electroelution system (Whatman plc, Maidstone, UK). Pooled 5S rRNAs were precipitated with ethanol and resuspended in RNA buffer (20 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 mM MgCl2, 10% (v/v) glycerol).
4
In Vitro Transcription and Purification of Guide RNAs and Substrates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding guide RNAs (snR34, snR5, Pf4 and variants thereof) were polymerase chain reaction (PCR)-amplified including a T7 promoter (for primers, see Supplementary Table S1 ). For variants of the snR34 5′ hairpin, the template DNA for in vitro transcription was assembled from two partially complementary oligos in a PCR reaction. RNAs were in vitro transcribed as described (31 (link)) and purified from urea-PAGE with the Elutrap Electroelution System (Whatman) followed by ethanol precipitation. All RNA concentrations were determined by spectroscopy (A260) using extinction coefficients calculated by OligoAnalyzer 3.1 (IDT).
Substrate RNAs complementary to the snR34 pseudouridylation pockets in the 5′ and 3′ hairpin (termed 5′ and 3′ substrate, respectively) were generated by in vitro transcription using annealed oligonucleotides as template in the presence of [C5–3H]-UTP. Substrate RNA was purified with a Nucleobond AX100 column (Macherey and Nagel). Following RNA binding, the column was washed with 100 mM Tris-acetate (pH 6.3), 10 mM MgCl2, 15% ethanol, 300 mM KCl. The RNA was eluted in the same buffer containing 1150 mM KCl followed by ethanol precipitation. Scintillation counting and A260 measurements were used to quantify the RNA concentration and specific activity.
Substrate RNAs complementary to the snR34 pseudouridylation pockets in the 5′ and 3′ hairpin (termed 5′ and 3′ substrate, respectively) were generated by in vitro transcription using annealed oligonucleotides as template in the presence of [C5–3H]-UTP. Substrate RNA was purified with a Nucleobond AX100 column (Macherey and Nagel). Following RNA binding, the column was washed with 100 mM Tris-acetate (pH 6.3), 10 mM MgCl2, 15% ethanol, 300 mM KCl. The RNA was eluted in the same buffer containing 1150 mM KCl followed by ethanol precipitation. Scintillation counting and A260 measurements were used to quantify the RNA concentration and specific activity.
5
In vitro Transcription and Purification of h45 RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 28-nucleotide unmodified h45 RNA (h45, 5′-GGUAAGUGUACUGGAAAGUGCACUUGCC-3′) was transcribed in vitro with T7 RNA polymerase, which added ‘GG’ and ‘CC’ to its 5′ and 3′ ends, respectively (Supplementary Figure S1A ), for efficient transcription (43 (link)). The transcription reaction, containing 40 mM Tris–HCl, pH 8.1, 1 mM spermidine, 0.01% (v/v) Triton X-100, 10 mM DTT, 25 mM MgCl2, 0.1 μM single-stranded DNA template (5′-GGCAAGTGCACTTTCCAGTACACTTACCTATAGTGAGTCGTATTAATTTC-3′), 0.1 μM T7 promoter primer (5′-GAAATTAATACGACTCACTATAG-3′), 1 mg of T7 promoter, and 5 mM each of unlabeled or 13C- or 15N-labeled NTPs (SILANTES GmbH), was incubated for 4 h at 37°C. Target RNA was further purified by electrophoresis on large 12% denaturing urea-PAGE gels, electroeluted in 0.5× Tris-borate/EDTA buffer using the Elutrap Electroelution System (Whatman), then desalted and buffer exchanged extensively into NMR buffer (10 mM sodium phosphate, pH 6.5, containing 50 mM sodium chloride) using Amicon Ultra centrifugal filter devices (Millipore).
Modified h45 RNA (m62A-h45, 5′-UAAGUGUACUGGm62Am62AAGUGCACUUG-3′) was purchased from Biomers (http://www.biomers.net , Germany) and exchanged into the same NMR buffer.
Modified h45 RNA (m62A-h45, 5′-UAAGUGUACUGGm62Am62AAGUGCACUUG-3′) was purchased from Biomers (
6
Synthesis and Purification of U1939-Containing 23S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 30nt U1939-containing 23S rRNA 5’-1932GCGAAAUUCCUUGUCGGGUAAGUUCCGACC1961-3’ was obtained by using in-vitro RNA transcription. The transcription primer is 5’-GAAATTAATACGACTCACTATAGCGAAATTCCTTGTCGGGTAAGTTCCGACC-3’ with a 22nt T7 promoter pair region at the 5’ site. The 10ml transcription mixture contains 10mM DTT, 5mM dNTPs, 5mM MgCl2, 300nM T7 promoter, 300nM Primer, 1mg T7 RNA polymerase, and was diluted in 40mM Tris, pH8.1 buffer. The mixture was incubated at 37°C for 4 hours before heating it to 70°C for 20 minutes to quench the reaction. The mixture was then added with 1ml 0.5M EDTA, 1ml 5mM NaCl and 25ml pre-cold ethanol to precipitate the RNA.
The RNA precipitate was first collected by centrifugation at 15000g for 30 minutes. After removing the supernatant, the pellet was dried and dissolved in 1.5ml DEPC water. RNA was then purified by electrophoresis on urea-containing denaturing polyacrylamide gels at 120W. The RNA was visualized by UV-shadowing, and excised from the gel. The RNA was further eluted using the Elutrap Electroelution System (Whatman) at 150 V overnight. The purified RNA was then washed with 2M NaCl, and then desalted and exchanged into DEPC to a final concentration of 1.6M.
The RNA precipitate was first collected by centrifugation at 15000g for 30 minutes. After removing the supernatant, the pellet was dried and dissolved in 1.5ml DEPC water. RNA was then purified by electrophoresis on urea-containing denaturing polyacrylamide gels at 120W. The RNA was visualized by UV-shadowing, and excised from the gel. The RNA was further eluted using the Elutrap Electroelution System (Whatman) at 150 V overnight. The purified RNA was then washed with 2M NaCl, and then desalted and exchanged into DEPC to a final concentration of 1.6M.
7
RNA Transcription of Viral Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pUC19 plasmids carrying different RNA clones were amplified in E. coli XL10-Gold ultracompetent cells. Large-scale DNA plasmid preparation was performed using QIAGEN Plasmid Mega Kit (Qiagen). Each plasmid was linearized using a specific restriction enzyme (Table 1 with underlined recognition sites for each RNA construct). Each in vitro RNA transcription by T7 RNA polymerase [86 (link)] was performed in solution with a mixture of transcription buffer, MgCl2, NTPs, and a corresponding linearized DNA template [52 (link)]. RNAs were then purified in 5 % (HIV-2 RNA constructs) and 6 % (HIV-1 and SIVcpz RNA constructs) denaturing PAGE gels (National Diagnostics) and extracted using Elutrap Electroelution system (Whatman). The final RNA product was obtained after two 2 M NaCl washes and eight ddH2O washes using Amicon ultra centrifugal filter units (Millipore).
8
In Vitro Transcription and Purification of RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were prepared by in vitro transcription as described previously (27 (link)). The reactions (15 to 30 mL) each contained ∼0.5 mg of PCR-amplified DNA template, 20 mM MgCl2, 3 to 6 mM nucleoside triphosphates (NTPs), 2 mM spermidine, 2 mM dithiothreitol (DTT), 20% (volume [vol]/vol) dimethyl sulfoxide, 80 mM Tris⋅HCl (pH 9.0), and 0.3 mg T7 RNA polymerase (purified in-house). The reaction was quenched after a 5-h incubation at 37 °C by addition of an ethylenediaminetetraacetate (EDTA)/urea mixture (250 mM EDTA and 7 M urea, pH 8.0), followed by boiling for 5 min and snap cooling on ice for 5 min; 50% glycerol was added to the sample to a final concentration of 6% (vol/vol). RNAs were purified by electrophoresis on urea-containing polyacrylamide denaturing gels (SequaGel; National Diagnostics) at 20 W overnight, visualized by ultraviolet shadowing, and eluted using the Elutrap Electroelution System (Whatman) at 150 V overnight. The eluted RNAs were concentrated and washed twice with 2 M high-purity NaCl followed by washing eight times with ultrapure water using an Amicon Ultra Centrifugal Filter Device (Millipore).
9
In vitro Transcription and Purification of RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were prepared by in vitro transcription using T7 RNA polymerase (purified in-house) in 7.5- to 30-mL reactions. A 7.5-mL reaction contained ∼0.25 mg of PCR-amplified DNA template or ∼4 nmol of annealed DNA template, 20 mM MgCl2, 3 to 6 mM NTPs, 2 mM spermidine, 2 mM DTT, 20% (vol/vol) DMSO, 80 mM Tris⋅HCl (pH 9.0), and 0.15 mg of T7 RNA polymerase. The reaction was quenched after a 5-h incubation at 37 °C by addition of an EDTA-urea mixture (250 mM EDTA, 7 M urea, pH 8.0). The reaction mixture was boiled for 5 min and snap cooled on ice for 5 min prior to addition of glycerol (final concentration, 6% [vol/vol]). RNAs were purified by electrophoresis on urea-containing polyacrylamide denaturing gels (SequaGel; National Diagnostics) at 20 W overnight, visualized by UV shadowing, and eluted using the Elutrap electroelution system (Whatman) at 150 V overnight. The eluted RNAs were concentrated and washed twice with 2 M high-purity NaCl followed by extensive desalting using Amicon Ultra Centrifugal Filter Device (Millipore).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!