The full-length of human PTP1B (hPTP1B) coding gene sequence PTPN1 (CCDS 13430.1; nucleotide ID: NM_002827.4; protein ID: NP_002818.1, 435 aa) codon optimised for Escherichia coli was obtained from OriGene (Rockville, MD, USA). The expression vector pET-28a(+) was obtained from Invitrogen (Waltham, MA, USA). E. coli strain DH5α and BL21 (DE3) were purchased from Invitrogen (Waltham, MA, USA). DNA extraction was performed with Kit QIAprep Spin Miniprep (Qiagen, Hilden, Germany). The forward-reverse pair primers for the expression of the three hPTP1B constructs, IPTG, imidazole, dithiothreitol (DTT), p-nitrophenyl phosphate (pNPP), chlorogenic acid (CGA), ursolic acid (UA), suramin (SUR), sodium orthovanadate (SO) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Compound 5 b was synthesised from 18β-glycyrrhetinic acid according to the procedure of Ledy De-la-Cruz-Martínez and collaborators28 (link).
E coli dh5α strain
Manufactured by Thermo Fisher Scientific
Sourced in United States
The E. coli DH5α strain is a commonly used laboratory strain of the bacterium Escherichia coli. It is a non-pathogenic strain that is often utilized for cloning and plasmid amplification experiments in molecular biology research.
Automatically generated - may contain errors
Lab products found in correlation
Qiaprep spin miniprep kit, by Qiagen (2 mentions)
E coli, by American Type Culture Collection (2 mentions)
Plasmid ppiczαa, by Thermo Fisher Scientific (2 mentions)
Pet 28b vector, by GenScript (2 mentions)
Fluo 4 am, by Thermo Fisher Scientific (2 mentions)
Endofree plasmid giga kit, by Qiagen (2 mentions)
E coli bl21 de3 strain, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Imidazole, by Merck Group (1 mentions)
Pet28a, by Thermo Fisher Scientific (1 mentions)
Bl21 de3, by Thermo Fisher Scientific (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Merck Group (1 mentions)
Dithiothreitol (dtt), by Merck Group (1 mentions)
Ni nta resin, by Qiagen (1 mentions)
E coli dh5α, by Thermo Fisher Scientific (1 mentions)
Bl21 de3, by Merck Group (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (1 mentions)
Ppiczα, by Thermo Fisher Scientific (1 mentions)
Ppic9, by Thermo Fisher Scientific (1 mentions)
36 protocols using e coli dh5α strain
1
Optimized Expression of Human PTP1B
2
DENV-1 Envelope Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DENV-1 E gene (~1.3 kb: Genbank accession no: JX292264) codon-optimized for expression in P. pastoris system was custom synthesized by GeneScript, New Jersey, USA. E.coli strain DH5α, P. pastoris strain KM71H and expression plasmid pPICZA were procured from Invitrogen Life Technologies, Carlsbad, USA. Vero and BHK-21 cell lines were purchased from American Type Cell Culture (ATCC), Virginia, USA. WHO reference viral strains DENV-1 (WP 74), DENV-2 (S16803), DENV-3 (CH53489), DENV-4 (TVP-360); E. coli clones expressing MBP (Maltose Binding Protein) and MBP-EDIII-1 (EDIII domain of DENV-1 fused with MBP) fusion proteins were received from Dr. Aravinda de Silva, University of North Carolina (UNC), USA. All mAbs used in this study were the same as before [13 (link), 14 (link)]. Concanavalin A (Con A) peroxidase conjugate was purchased from Sigma-Aldrich. Goat anti-mouse and anti-human IgG monoclonal antibody-HRPO conjugates and anti-mouse fluorescein isothiocyanate (FITC) conjugate were procured from Life Technologies, USA and Merck, Germany, respectively. Ni-NTA resin was procured from Qiagen, Hilden, Germany. High binding, polystyrene ELISA plates were purchased from Corning Incorporated, USA. N-linked oligosaccharide profiling was performed at GlycoSolutions Corp., Marlborough, USA.
3
scFv7F9Cys Construction and Cell Line Development
4
Bacterial Strain Utilization in Subcloning and Protein Display
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli strain RR1∆M15 [56 (link)] and E. coli strain DH5α (Invitrogen, Carlsbad, CA) were used for subcloning work. E. coli strain BL21 (DE3) (Merck, Darmstadt, Germany) was used for cell surface display. E. coli DH5α (Invitrogen) was used for OmpT-mediated release of recombinant protein into the medium.
5
Amplification and Characterization of Mammalian Interspersed Repeats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A population of mammalian interspersed repeats (MIRs) was amplified by PCR using degenerate primers (Supplementary Table S1 ) that targeted the ends of consensus sequences of MIR subfamilies (42 (link)). The amplicons were obtained with a mixture of human DNAs using varying annealing temperatures at 1.5 mM Mg2+, were sized between 224 and 268 nts and contained high densities of BP motifs (Supplementary Table S2 ). The PCR products were separated on 1% agarose gels. The indicated fragments were extracted with the GeneJET Gel Extraction Kit (ThermoFisher), digested and cloned into the unique PstI or EcoRV site introduced upstream or downstream of the dBP cluster, respectively, permitting both sense and antisense MIR orientations. Ligation reactions were introduced into the E. coli strain DH5α (Invitrogen) by transformation. Plasmid DNA was extracted with the GeneJET Plasmid Miniprep kit (ThermoFisher) and correctly sized inserts were confirmed by gel electrophoresis following digestions with restriction enzymes. Sanger sequencing of 30 plasmids confirmed 9 (PstI) and 16 (EcoRV) constructs with unique MIR inserts (Supplementary Table S3 ). Plasmid DNA was individually transfected into human embryonic kidney cells (HEK293) to examine the impact of sense and antisense MIRs on exon 4a/4b and BP usage.
6
Recombinant Protein Production in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
P. pastoris strain GS115, E. coli strain DH5α and expression vectors pPIC9 and pPICZα were purchased from Invitrogen (Life Technologies, Carlsbad, CA). Anti-Agkisacutacin monoclonal antibody 1B9 was obtained from Zhaoke Pharmaceutical (Hefei) Co. Ltd. as described previously.3 HPR-conjugated anti-mouse antibodies were purchased from Cell Signaling Technology (Beverly, MA). The 14 L fermentor (New Brunswick BioFlo 115) used in the pilot-scale fermentation process was obtained from Eppendorf (Enfield, CT). FlexStand Systems with 0.45 μm, 500 kDa and 10 kDa hollow-fibre membrane filtration cartridges were obtained from GE Healthcare (Piscataway, NJ), and the AKTA avant System with CM FF and S-100 HR columns was obtained from GE Healthcare (Uppsala, Sweden). The high-performance liquid chromatography (HPLC) system (LC-20AD) with a TSK3000SW 5 μm 250 mm × 4.6 mm column (Tosoh Co., Tokyo, Japan) was obtained from Shimadzu (Kyoto, Japan). The ELX800 microplate reader was obtained from Bio-Tek (Winooski, VT). The BD FACSVerse flow cytometer was obtained from BD BioSciences (Franklin Lakes, NJ). The analysis software FlowJo was obtained from Tree Star (San Carlos, CA).
7
Bacterial Strain Cultivation and DNA Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli strain
DH5α was obtained from Invitrogen (Grand Island, NY) and Rosetta(DE3)pLysS
was obtained from Novagen (Madison, WI). Pfu DNA
polymerase was obtained from Stratagene (La Jolla, Ca). Deoxy-ribonucleotides
were purchased from Sigma Genosys (The Woodlands, TX). The QIA prep
Spin Mini-Prep kit and QIA quick polymerase chain reaction (PCR) purification
kits were obtained from Qiagen (Valencia, CA). Luria–Bertani
agar, Luria–Bertani broth, chloramphenicol, isopropyl β-d -thiogalactonopyranoside, lysozyme, phenazine methosulfate
(PMS), and phenylmethanesulfonyl fluoride were purchased from Sigma-Aldrich
(St. Louis, MO). Bovine serum albumin was obtained from Promega (Madison,
WI). All other reagents were of the highest purity commercially available.
DH5α was obtained from Invitrogen (Grand Island, NY) and Rosetta(DE3)pLysS
was obtained from Novagen (Madison, WI). Pfu DNA
polymerase was obtained from Stratagene (La Jolla, Ca). Deoxy-ribonucleotides
were purchased from Sigma Genosys (The Woodlands, TX). The QIA prep
Spin Mini-Prep kit and QIA quick polymerase chain reaction (PCR) purification
kits were obtained from Qiagen (Valencia, CA). Luria–Bertani
agar, Luria–Bertani broth, chloramphenicol, isopropyl β-
(PMS), and phenylmethanesulfonyl fluoride were purchased from Sigma-Aldrich
(St. Louis, MO). Bovine serum albumin was obtained from Promega (Madison,
WI). All other reagents were of the highest purity commercially available.
8
Thanatin Sequence Cloning and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The thanatin sequence in plasmid vector (pGHvector+thanatin) was artificially ordered. First, pGH and pcDNA3.1+ vectors were digested separately with HindIII restriction enzymes (Thermo Fisher Scientific, USA) and then purified by gel extraction kit (Thermo Fisher Scientific, USA). Then, the purified products were again digested with BamHI restriction enzyme (Thermo Fisher Scientific, USA) and purified. The next step in constructing a recombinant plasmid was to ligate the thanatin DNA sequence into a compatibly digested vector backbone by fast ligation kit (Thermo Fisher Scientific, USA). Subsequently, the recombinant plasmid was transformed into the E. coli strain DH5α (Invitrogen, USA). In order to identify DH5α containing recombinant plasmids, the bacteria were cultured on antibiotic culture medium. Only the bacteria containing the recombinant plasmid could be colonized on the culture medium containing antibiotics. Colony PCR was performed by universal pcDNA3.1+ primers for T7 promoter (forward: TAATACGACTCACTATAGGG) and BGH (reverse: TAGAAGGCACAGTCGAGG). Afterwards, colonies were harvested and plasmid elicitation was performed by HiPure Plasmid Isolation kit (Roche, Germany). Finally, mapping and sequencing were carried out.
9
Heterologous Protein Expression in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
P. pastoris strain X-33, E. coli strain DH5α, and pPICZα-A plasmid were bought from Invitrogen Corporation (Carlsbad, CA, USA). They were used for gene manipulation and heterologous protein expression. E. coli American Type Culture Collection (ATCC) 25922, E. coli H7: O157 ATCC 35150, Bacillus subtilis AHU 1035, S. aureus ATCC 25923, L. monocytogenes ATCC 21633, Pseudomonas aeruginosa ATCC 27853, and Salmonella enteriditis ATCC 10467 were obtained from the ATCC (http:// www. atcc. org/). Restriction enzymes and T4 ligase for DNA fragments cloning were purchased from Life Technologies Corporation (Carlsbad, CA, USA) and Ni-NTA resin for protein purification were bought from GE Healthcare Corporation (Chicago, IL, USA). All other chemicals were bought from Solarbio (Beijing, China).
10
Bacterial Growth Conditions for Vaccine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virulent S. Enteritidis PT1 and the non-virulent mutant S. Enteritidis ΔaroA::Kan were used. AroA is implicated in the chorismic acid biosynthesis pathway, a central metabolic node [15, 16] . This mutant was used as a control to DNA-vaccinated mice. Cells were grown under aerobic conditions in Luria-Bertani (LB ) broth for 18 h at 37 °C. E. coli BL21 (DE3) pLys (Novagen, USA) and E. coli strain DH5α (Invitrogen, USA) were grown at 37 °C in TB, supplemented with 50 μg/ml kanamycin as required.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!