Bas ip ms storage phosphor screen

Primed template was prepared by annealing 500 nM oligonucleotide (sequence: 5′‐GAATAATGGAAGGGTTAGAACCTACCAT) to 50 nM M13mp18 ssDNA (New England Biolabs) in 10 mM Tris–HCl pH 7.6, 100 mM NaCl and 5 mM EDTA. The mixture was heated to 75°C and gradually cooled to room temperature. Unannealed oligonucleotide was removed using S400 column (GE Healthcare). The primer extension reaction was performed at 37°C in a buffer containing 25 mM HEPES‐KOH (pH 7.6), 100 mM potassium glutamate, 0.01% NP‐40‐S, 1 mM DTT, 10 mM Mg(OAc)₂, 0.1 mg/ml BSA, 3 mM ATP, 400 μM CTP, GTP, UTP, 30 μM dATP, dCTP, dGTP, dTTP, 33 nM α‐[³²P]‐dCTP. 1 nM primed templated was pre‐incubated with 250 nM RPA for 5 min. 20 nM PCNA and 4 nM RFC were added, and the reaction was initiated by the addition of 20 nM Pol ε. Aliquots were removed at the indicated time points and stopped with 50 mM EDTA. Unincorporated nucleotide was removed with illusta MicroSpin G‐50 columns (GE Healthcare), and samples were run on 0.6% alkaline agarose gel at 23 V for 16 h. The gel was fixed with cold 5% trichloroacetic acid and dried onto Whatman paper. The gel was exposed on BAS‐IP MS Storage Phosphor Screen (GE Healthcare), and screen was developed on a Typhoon laser imager (GE Healthcare).

Native agarose gels and acrylamide gels were dried directly onto 3MM chromatography paper (GE Healthcare). Alkaline agarose gels were fixed with two 15 min incubations at 4°C in 5% trichloroacetic acid solution before drying on 3MM chromatography paper (GE Healthcare). For quantification, gels were exposed on BAS-IP MS Storage Phosphor Screens (GE Healthcare) and imaged on a Typhoon phophorimager (GE Healthcare). Gels were also autoradiographed using Amersham Hyperfilm MP (GE Healthcare) for presentation.