15n glutamine

The constructs for mouse injection, including pT3-EF1α-c-MYC, pT3-EF1α-MCL1 and pCMV-SB (which encodes for sleeping beauty transposase), and pCMV-CRE (which encodes for CRE recombinase), were previously described⁵⁸ . miR30-based shRNA targeting for Gls2 and Renilla Luciferase were cloned into pT3-EF1α-c-MYC. The shRNA sequences are: Gls2: CATCATGCCAACAAGCAACTT and Renilla Luciferase: AGGAATTATAATGCTTATCTA. All plasmids used for in vivo experiments were purified using the Endotoxin-free Maxiprep kit (Qiagen). [U-¹³C]-glucose, [U-¹³C]-glutamine, ¹⁵N-glutamine and ¹⁵N-alanine were purchased from Cambridge Isotope Laboratories, Inc.

For glutamine flux, media without added glutamine (Corning 17-207-CV) was supplemented with ¹³C glutamine (fully labeled) or ¹⁵N glutamine (amide labeled) (Cambridge Isotope Labs). For glucose flux, media without added glucose (Corning 17-207-CV) was supplemented with ¹³C glucose (fully labeled) (Cambridge Isotope Labs). Cells were plated in 10cm dishes and grown in normal media. 1 hour prior to metabolite extraction, media was aspirated and replaced with heavy isotope-labeled media.

Glutamine-free RPMI-1640 media (cat no-15-040-cv) was supplemented with 10% dialyzed serum and 4 g/L [¹⁵N] glutamine (Cambridge Isotope Labs). For glutamine-flux analysis, 5637 cells were maintained in glutamine-free RPMI-1640 media overnight. Next, media was replaced with media containing [¹⁵N] glutamine-containing (5 mM) but not for control cells. After 12, 24, 48 and 72 hours of [¹⁵N] glutamine labeling, cells were collected and the DNA extracted.