DNA from tissues was extracted after whole‐organ homogenization using the QIAgen Blood Core Kit B precipitation method. Vector genome copy number was determined using a qPCR assay using 100 ng of DNA. The hAAT promoter‐specific primers and the probe (forward primer 5′‐GGCGGGCGACTCAGATC‐3′, reverse primer 5′‐GGGAGGCTGCTGGTGAA TATT‐3′, probe (FAM) 5′‐AGCCCCTGTTTGCTCCTCCGATAACTG‐3′ (TAMRA)) were synthesized by Thermo Scientific (Waltham, MA, USA). Mouse titin was used as a normalizing gene (forward primer 5′‐AAAACGAGCAGTGACGTGAGC‐3′, reverse primer 5′‐TTCAGTCATGCTGCTAGCGC‐3′, probe (VIC) 5′‐TGCACGGAAGCGTCTCGTCT CAGTC‐3′ (TAMRA) synthesized by Thermo Scientific (Waltham, MA, USA)). Each sample was tested in triplicate.
Probe fam
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Probe (FAM) is a fluorescent dye-labeled oligonucleotide probe designed for use in real-time PCR and other nucleic acid detection assays. The FAM (6-carboxyfluorescein) fluorescent dye is attached to the 5' end of the probe. The probe is designed to hybridize to a specific target sequence, and the fluorescent signal is generated upon probe cleavage or hybridization.
Automatically generated - may contain errors
Lab products found in correlation
Tamra, by Thermo Fisher Scientific (1 mentions)
Vic probe, by Thermo Fisher Scientific (1 mentions)
Blood core kit b, by Qiagen (1 mentions)
Tracrrna atto 550, by Integrated DNA Technologies (1 mentions)
Custom taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Geneticin g418, by Merck Group (1 mentions)
2 protocols using probe fam
1
Quantifying Vector Genome Copies in Tissues
2
CRISPR-Cas9 Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers, ssODN HDR donor templates, quantitative real-time PCR assays (human CFTR, Hs.PT.58.28207352; human TBP, Hs.PT.58v. 39858774; human GusB, Hs.PT.58v.27737538; rat GusB, Rn.PT.58. 35199448), and Alt-R® CRISPR Cas9 reagents (S.p. Cas9 Nuclease 3NLS; crRNA; tracrRNA; and tracrRNA, ATTO 550 ) were purchased from Integrated DNA Technologies (IDT). SNP discrimination assays were custom ordered from IDT [F508del: primer 1 5′-ATTATGCCT GGCACCATTA-3′; primer 2 5′-TGATGACGCTTCTGTATCTA-3′; probe (FAM) 5′-AATATCATCTTTGGTGTTTCCT-3′; probe (HEX) 5′-AATATC ATTGGTGTTTCCTATGA-3′] or purchased from Thermo Fisher Scientific (W1282/X assay: C__32545014; G542/X assay: C__11399026; M470/V470 assay: Custom TaqMan SNP Genotyping Assay, human). WT (ND03719), W1282X (GM11723), and G542X (GM11496) samples for genotype control were purchased from Coriell Biorepository. Geneticin (G418) was purchased from Sigma-Aldrich (A-1720) and SMG1i was custom-synthesized by Kalexsyn (Kalamazoo, MI).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!