SiRNAs targeting circCCDC66 were synthesized by GenePharma (Shanghai, China). MiRNA mimics, inhibitor, mimics NC, inhibitor NC, and SiRNAs were provided by GenePharma. pcDNA3.1 circRNA mini construction comprising circCCDC66 was a highly expressed cassette, and pcDNA3.1 including FOXM1 indicated over-expressed plasmid. The above-mentioned plasmids were separately transfected into indicated cells by Lipofectamine 3000 (Invitrogen) as manual instructions. The sequence was as follows: si-circCCDC66, CAAUUAGAGCAUCAGGAAA; si-NC, UUCUCCGAACGUGUCACGUTT.
Sirnas
Manufactured by GenePharma
Sourced in China, United States
SiRNAs (Small Interfering RNAs) are short, double-stranded RNA molecules that play a key role in the RNA interference (RNAi) process. The core function of SiRNAs is to target and degrade specific mRNA molecules, thereby inhibiting the expression of targeted genes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (168 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (84 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (46 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (24 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (19 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (18 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (16 mentions)
Si nc, by GenePharma (14 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (14 mentions)
Mirna mimic, by GenePharma (13 mentions)
Sirnas, by Thermo Fisher Scientific (12 mentions)
Opti mem, by Thermo Fisher Scientific (12 mentions)
Mirna inhibitor, by GenePharma (9 mentions)
Lipofectamine 3000 transfection kit, by Thermo Fisher Scientific (8 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (7 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (7 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (7 mentions)
Control sirna, by GenePharma (6 mentions)
Opti mem medium, by Thermo Fisher Scientific (6 mentions)
Nc sirna, by GenePharma (5 mentions)
565 protocols using sirnas
1
Targeting circCCDC66 in cancer cells
2
Targeted siRNA Silencing of Key Regulatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We purchased the following siRNAs (GenePharma, Shanghai, China) that specifically target BATF-1, BATF-2, and TGFβ1:
si-BATF-1 sense: 5’-GCAGAAGAGUAUUAAGAAAGA-3’,
si-BATF-1 antisense: 5’-UUUCUUAAUACUCUUCUGCAU-3’;
si-BATF-2 sense: 5’-GGCCCAAUGCAGAAGAGUAUU-3’,
si-BATF-2 antisense: 5’-UACUCUUCUGCAUUGGGCCUG-3’;
si-TGFβ1 sense: 5’-GCAUAUAUAUGUUCUUCAACA-3’,
si-TGFβ1 antisense: 5’-UUGAAGAACAUAUAUAUGCUG-3’.
We used scrambled siRNAs as negative controls. We used the siRNAs with highest silencing effect for further studies.
si-BATF-1 sense: 5’-GCAGAAGAGUAUUAAGAAAGA-3’,
si-BATF-1 antisense: 5’-UUUCUUAAUACUCUUCUGCAU-3’;
si-BATF-2 sense: 5’-GGCCCAAUGCAGAAGAGUAUU-3’,
si-BATF-2 antisense: 5’-UACUCUUCUGCAUUGGGCCUG-3’;
si-TGFβ1 sense: 5’-GCAUAUAUAUGUUCUUCAACA-3’,
si-TGFβ1 antisense: 5’-UUGAAGAACAUAUAUAUGCUG-3’.
We used scrambled siRNAs as negative controls. We used the siRNAs with highest silencing effect for further studies.
3
Silencing SIRT5 and GLUD1 in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiRNAs specifically targeting SIRT5 and GLUD1 were purchased from GenePharma (Shanghai, China) using the following sequences: SIRT5: siRNA-1, 5′-GCUGGAGGUUAUUGGAGAATT-3′; siRNA-2, 5′-GUGGCUGAGAAUUACAAGATT-3′. These SiRNAs were used as a pool for siRNA transfection. GLUD1: siRNA, 5′-GCGUUCUGCCAGGCAAAUUTT-3′; HCT116 and LoVo cells were seeded at 30% confluence in six-well plates overnight before transfection, and then transfected with 50 nM siRNA using Dharma FECT 1 transfection reagent (Dharmacon, Lafayette, CO, USA), according to the manufacturer’s instructions. A nonspecific siRNA (GenePharma) was used as a negative control.
4
Investigating Xist Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNAs (siRNAs) targeting Jpx and siRNAs targeting non-specific control (NC) were obtained from GenePharma (Shanghai, China). Jpx and CTCF-expression plasmids were purchased from Biogot Technology (Nanjing, China). A 2kb fragment encoding Xist gene promoter was fused to PGL3-Basic luciferase reporter vector (Promega, Madison, WI, USA). SiRNAs were transfected by Hiperfect transfection reagent (Qiagen, Valencia, CA, USA) and the transfection of plasmids was conducted using Lipofectamine 3000 transfection reagent (Invitrogen). Luciferase activity was measured using the Dual Luciferase Assay System (Promega) and pRL-TK plasmid was used as an internal control.
5
Knockdown of SSRP1 in Colorectal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SW620 and HCT15 cells were transfected with siRNAs, which were purchased from Genepharma (Suzhou, China) and the sequences of siRNAs were as follows: siSSRP1-1 sense, 5'-GCCAUGUCUACAAGUAUGATT-3' and antisense, 5'-UCAUACUUGUAGACAUGGCTT-3'; siSSRP1-2 sense, 5'-CCCAGAAUGGUGUUGUCAAATT-3' and antisense, 5'-UUUGACAACACAUUCUGGGTT-3'; negative control sense, 5'‑CACGCAGAACGTGAACACC‑3' and antisense, 5'‑GGCAGTAGATAACGTGAGGGA‑3'. Prior to transfection, cells were cultured in 96-well plates or 6-well plates ensuring that these cells had reached 80% confluency the next day. The thermo transfection agent Interferin (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used according to the manufacturer's protocol. Cells were collected after transfection at 48-72 h.
6
Modulating TBK1 and MAZ in Thyroid Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs targeting TBK1 and its negative control (si‐NC), TBK1 overexpression plasmid and its negative control (pc‐NC), siRNAs targeting Myc‐associated zinc finger protein (MAZ) and its si‐NC, and MAZ overexpression plasmid and its pc‐NC were obtained from GenePharma. Thyroid cancer cells were transfected with TBK1 siRNAs and si‐NC, pc‐TBK1 and pc‐NC, MAZ siRNA and si‐NC, pc‐MAZ, and pc‐NC by using Lipofectamine 3000 for 48 h.
7
Silencing SPRY4-IT1 and EZH2 in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two siRNAs targeting SPRY4‐IT1 (#1 5′‐GCTTTCTGATTCCAAGGCCTATTAA‐3′, #2 5′‐GGTGGTTGAAAGGAATCCT‐3′); two siRNAs targeting EZH2 (#1 5′‐GGAUGGUACUUUCAUUGAAGA‐3′, #2 5′‐GCAAAGUACUGUAAGAAUAAU‐3′); and a miR‐101‐3p inhibitor (5′‐UUCAGUUAUCACAGUACUGUA‐3′) were synthesized by GenePharma. Plasmids overexpressing SPRY4‐IT1 and EZH2 were constructed based on the pcDNA3.1 vector, purchased from the GeneCreate Biological Company. The glioma cells were seeded in six‐well plates and transfected when the cells reached a confluence of 60%–70% on the second day. Cell transfection was carried out using Lipofectamine 3000 (Invitrogen) according to the manufacturer's protocol. The cells were collected for subsequent experiments 48 h post‐transfection.
8
Transfection and siRNA Targeting circEPSTI1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA). All siRNAs targeting circEPSTI1 were synthesized by GenePharma (Shanghai, China). All miRNA mimics or inhibitors were synthesized by GeneCopoeia (Rockville, MD, USA). The sequences that were used are presented in Table S1 .
9
Autophagy and FOXO1 Gene Silencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNAs for autophagy-related gene 5 (ATG5) and FOXO1 were synthesized by GenePharma Corporation (Shanghai, China). Two siRNA sequences for ATG5 were: 5'-GCUUCGAGAUGUGUGGUUUTT-3' and 5'-AAACCACACAUCUCGAAGCTT-3'; 5'-CCAUCAACCGGAAACUCAUTT-3' and 5'-AUGAGUUUCCGGUUGAUGGTT-3' (20 (link)); Two siRNA sequences for FOXO1 were: 5'-UGUAAUGAUGGGCCCUAAUTT-3' and 5'-AUUAGGGCCCAUCAUUACATT-3'; 5'-GCGGGCUGGAAGAAUUCAATT-3’ and 5'-UUGAAUUCUUCCAGCCCGCTT-3' (21 (link),22 (link)). Negative control siRNA was scrambled sequence without any specific target: 5'-UUCUCCGAACGUGUCACGUTT-3' and 5'-ACGUGACACGUUCGGAGAATT-3'. Transfection of siRNA in MLVECs was performed by using the Lipofectamine TM3000 (Thermo Fisher) according to the manufacturer’s instructions.
10
Pig NORHA and FoxO1 siRNAs, miR Modulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs specific: 1/ to pig NORHA and FoxO1, and 2/ to mimics and inhibitors of miR-183, miR-96 and miR-182 (Tab. S7 ) were generated by GenePharma (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!