Pegfp c1 plasmid

To obtain the U2AF35-EGFP construct, we use LLC-MK2 cDNA as a template and U2AF35 specific primers (forward: 5’-GGATCCTCAGAATCGCCCAGATCTTT-3’ and reverse: 5’-CTCGAGTTGCGGAGTATCTGGCCTCCA-3’). Next, we cloned in a frame the U2AF35-EGFP sequence into a pEGFP-C1 plasmid (Clontech, USA) and confirmed the sequence by sequencing (ABI 3500 XL, Applied Biosystems, USA). LLC-MK2 cell line was transfected with 0,1 µg U2AF35-EGFP or 0,1 µg empty-EGFP vector using Lipofectamine 2000 (Thermo Fisher Scientific, USA), according to the manufacturer’s recommendations. Then, LLC-MK2 transfected cells were infected with T. cruzi and fixed with PBS/paraformaldehyde 2% for 10 min, then stained with DAPI and Rhodamine phalloidin as described above.

FAK-WT-GFP, FAK-Y397F-GFP and FAK-I936E I998E-GFP were obtained as previously described [17 (link)]. The LD2-LD4-GFP sequence of paxillin (aa 136–296) was inserted into the pEGFP–C1 plasmid (Clontech, Kusatsu City, Japan), creating a fusion of enhanced GFP (EGFP) to the N terminus of paxillin. Melanoma cells were co-transfected with siRNA and 4 µg FAK WT or FAK mutant DNA or with LD2-LD4-GFP DNA 4 µg using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Transfected cells were incubated for 24 h at 37 °C before use.

The S. Typhimurium strains MC1 and MC71 were previously described [35 (link)]. The genes encoding the typhoid toxin (TT) or a toxin carrying a deletion of the cdtB subunit (ΔcdtB) were cloned into the pEGFP-C1 plasmid (Clontech Laboratories, Mountain View, CA, USA) as described in [70 (link)]. The gene encoding the chloramphenicol resistance (Cm) was amplified from the pKD3 plasmid (NCBI Gene Bank AY048742), using the following primers: 5’-AAAGGATCCGTGTAGGCTGGAGCTGCTTC-3’ and 5’-AAAGGTACCCATATGAATATCCTCCTTAG-3’, and cloned into the BamHI-KpnI sites of the pEGFP-C1-TT or pEGFP-C1-ΔcdtB plasmids. The toxin and the chloramphenicol genes were amplified using the primers 5’-GTCCGCACGTTCTTCCGTGGCGTGGATATTAGTCAGGTCTTTAGCGCCAAAGATATTGCCATTCTGTAACTGATAAAGTAGGTGTGCTTA-3’ and 5’-AAT GCCGCTTTTAATGAGTCGATGGACACGACGCCCACGAATTTATTGCATATGAATATCCTCCTTAG-3’, and transferred by homologous recombination into the genomic proV gene of S. Typhimurium strain LB5010 [71 (link)] carrying the pKD46 plasmid [72 (link)]. The MC1/MC71-TT and MC1/MC71-ΔcdtB strains were produced by P22int phage transduction, and grown overnight in Luria agar plates supplemented with Cm (10 μg/ml) [73 (link)]. The construction of these strains was approved by the Swedish Work Environment Authority.
The list of strains used in this work is summarized in Table 1.

Hippocampal neurons were transfected at 7 DIV using Lipofectamine 2000 (Thermo Fisher, Cat# 11668019). Experiments were carried out after 20–24 hr. The pEGFP-C1 plasmid is from Clontech (Addgene plasmid # 13031, RRID:Addgene_13031), the plasmids for EGFP-Rab10 WT (RRID:Addgene_49472), EGFP-Rab10 T23N (RRID:Addgene_49545), and EGFP-Rab10 Q68L (RRID:Addgene_49544) were a gift from Marci Scidmore (Huang et al., 2010 (link)), TrkB-FLAG plasmid was a gift from Francis Lee (Chen et al., 2005 (link)). Neuro-2a cells were transfected using Lipofectamine 3000 (Thermo Fisher, Cat# L3000001) and the experiments were done 48 hr later. The GFP-KIF13B plasmid (RRID:Addgene_134626) was a gift from Marvin Bentley (Yang et al., 2019 (link)), whilst the HA-Rab10 plasmid was provided by Dario Alessi and Miratul Muqit (Dundee University, DU44250).

To investigate HDR efficiency, we employed a model system based on a single nucleotide frameshift deletion (c.337delG) in the eGFP gene. Mutated eGFP was stably integrated into the genome of HEK293T cells to create HEK293T-eGFPmut cells. The production of mutated eGFP involved site-directed mutagenesis of the peGFP-C1 plasmid (ClonTech, Mountain View, CA, USA), resulting in peGFP-C1mut. To integrate mutated eGFP into the cells, we used lentiviral particles generated from the pCMV-dR8.91 and pMD2.G plasmids, generously provided by Prof. Didier Trono (http://tronolab.epfl.ch, accessed on 31 March 2023). We constructed the pLVT_turboRFP635-eGFPmut plasmid by cloning the eGFPmut coding sequence and the turboRFP-635 far-red protein gene coding sequence, separated by a T2A linker, into the plot vector (Addgene, Watertown, MA, USA). Lentivirus particles assembled from pCMV-dR8.91, pMD2.G, and pLVT_turboRFP635-eGFPmut were used to infect HEK293T cells at a multiplicity of infection of 5–7. Successfully transfected cells were identified by far-red fluorescence from turbo-RFP635 encoded in the same pLVT_turboRFP635-eGFPmut vector. Functional GFP, generated by HDR-mediated restoration of the eGFP gene, produced green fluorescence in the edited cells.