Quantitect sybr green pcr kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Japan, United Kingdom, Germany

The QuantiTect SYBR Green PCR Kit is a real-time PCR kit that enables sensitive and reliable quantification of DNA and cDNA targets. The kit includes a SYBR Green-based master mix and provides all necessary components for PCR amplification and detection.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SYBR Green (3216 citations) SYBR Green kit (254 citations) QuantiTect SYBR green (2 citations)

39 protocols using quantitect sybr green pcr kit

Heart Tissue RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from heart tissue using an Ambion RNAqueous kit (AM1912; AM) according to the manufacturer’s instructions. cDNA was generated from the total RNA using the High Capacity RNA-to-cDNA™ Kit (4387406). Quantitative polymerase chain reaction was performed using a QuantiTect SYBR Green PCR Kit and a real-time PCR system (StepOnePlus; Applied Biosystems Japan, Tokyo, Japan). The relative mRNA levels of ANP, BNP, IKKβ, PTEN, TGFβ and collagen were normalized to the level of Rn18s mRNA in the same sample.

Al-Huseini I., Harada M., Nishi K., Nguyen-Tien D., Kimura T, & Ashida N. (2019). Improvement of insulin signalling rescues inflammatory cardiac dysfunction. Scientific Reports, 9, 14801.

+ Open protocol

+ Expand

Quantitative PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol (Invitrogen) following the manufacturer’s instructions. RNA concentrations were determined with a Nano instrument (NanoDrop Technologies, Wilmington, DE). The first-strand cDNA was synthesized for each RNA sample using the Superscript III Reverse Transcriptase system (Invitrogen). Real-time quantitative PCR was performed on the iCycler (Biorad, UK) using the Quanti Tect SYBR Green PCR kit (Applied Biosystems). The forward and reverse primers for β-actin were designed using the Primer Premier software (Premier Biosoft International). The sequences of the PCR primer pairs were as follows: β-actin forward, 5′-GGA TGC AGA AGG AGA TCA CTG-3′ and reverse, 5′-CGA TCC ACA CGG AGT ACT TG-3′; TLR4 forward, 5′-AGT TTC CTG CAA TGG ATC AAGG-3′ and reverse 5′-CTG CTT ATC TGA AGG TGT TGC AC-3′; IL-6 forward, 5′-AGT GAG GAA CAA GCC AGA GC-3′ and reverse, 5′-CAG GGG TGG TTA TTG CAT CT-3′; IL-8 forward, 5′-GAC ATA CTC CAA ACC TTT CCA CCC-3′ and reverse, 5′-CCA GAC AGA GCT CTC TTC CAT CAG-3′. The human β-actin gene was used as an endogenous control for sample normalization. For each sample, the relative abundance of target mRNA was calculated from the obtained C_Δt values for both the target and endogenous reference β-actin genes using the 2^-ΔΔCt cycle threshold method.

Zhu Y., Dai B., Li Y, & Peng H. (2015). C5a and toll-like receptor 4 crosstalk in retinal pigment epithelial cells. Molecular Vision, 21, 1122-1129.

+ Open protocol

+ Expand

ChIP-seq of RPB3 and RPC62

Check if the same lab product or an alternative is used in the 5 most similar protocols

RPB3 and RPC62 ChlP-seq was performed as described in (Yu et al, Science, 2015 (link)) with the following modifications. Briefly, 2×l0⁷ cells were fixed in 1% formaldehyde for 10 min at room temperature. For RPB3 and RPC62 ChlP-seq, fragmentation of fixed chromatin was performed by sonication of isolated nuclei (Branson Sonicator, Branson) to achieve enrichment of short (100–500 bp) chromatin fragments. 5 μg of RPB3 antibody (A303–771A, Bethyl) or 1 μl of RPC62 anti-serum was added to the chromatin lysate and incubated overnight at 4°C. The next day, Dynabeads Protein A (Thermo Fisher Scientific) was added and incubated with rotation at 4°C for 1.5 hours. Enriched DNA was isolated through extensive wash steps and subsequent reverse cross-linking and purification. To quantify ChlP-qPCR signals, real-time PCR was performed in 20 μl reactions using QuantiTect SYBR Green PCR Kit with primers used at a final concentration of 10 μM on an Applied Biosystems 7300 Real-Time PCR System. Primer sequences are given in Table S1. ChlP-seq libraries were prepared from 5–10 ng ChIP DNA following the instructions of Illumina TruSeq ChIP Library Preparation Kit (IP-202–1012). Libraries were then sequenced on Illumina HiSeq 2500 as 75-bp single-end runs at the Genomics Resource Center at the Rockefeller University.

Gerber A., Ito K., Chu C.S, & Roeder R.G. (2020). Gene-Specific Control of tRNA expression by RNA Polymerase II. Molecular cell, 78(4), 765-778.e7.

+ Open protocol

+ Expand

Gene Expression Analysis of Vascular Smooth Muscle Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cultured VSMCs using an RNAqueous total RNA isolation kit (AM1912; Thermo Fisher Scientific K.K., Yokoyama, Japan) according to the manufacturer's instructions. cDNA was generated from total RNA using The High Capacity RNA‐to‐cDNA Kit (4387406). Quantitative PCR was performed using the QuantiTect SYBR Green PCR Kit and real‐time PCR system (StepOnePlus; Applied Biosystems Japan, Tokyo, Japan). Relative mRNA level of ostrix, alkaline phosphatase, and osteocalcin was normalized to the Rn18s mRNA level in the same sample.

Al‐Huseini I., Ashida N, & Kimura T. (2018). Deletion of IκB‐Kinase β in Smooth Muscle Cells Induces Vascular Calcification Through β‐Catenin–Runt‐Related Transcription Factor 2 Signaling. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 7(1), e007405.

+ Open protocol

+ Expand

qPCR Analysis of mcr-1 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Overnight cultures of E. coli DH10β pUC19, pUC19::mcr-1, pUC19::mcr-1_P198A, pUC19::mcr-1_P198Y, and pUC19::mcr-1_H478A were diluted 1:50 in fresh LB medium supplemented with 100 mg/L ampicillin. Afterward, bacteria were grown to an OD₆₀₀ of 1. Aliquots of 1 mL were mixed with RNAprotect reagent and pelleted by centrifugation (9,000 × g, 5 min at 4°C). The RNA was isolated using the miRNeasy minikit according to the manufacturer’s protocol. Synthesis of cDNA from RNA was performed via reverse transcription using SuperScript II reverse transcriptase and random hexamer and nonamer primers. The QuantiTect SYBR green PCR kit was used for cDNA amplification of mcr-1 and the reference 16S rRNA gene (primers are listed in Table S3) using the StepOnePlus real-time PCR system (Applied Biosystems, Darmstadt, Germany). The specificity of the amplicons was confirmed by melting curves and agarose gel electrophoresis. The experiments were done in three biological replicates. Relative quantification was calculated using the mathematical model described by Pfaffl (52 (link)).

Frantz R., Gwozdzinski K., Gisch N., Doijad S.P., Hudel M., Wille M., Abu Mraheil M., Schwudke D., Imirzalioglu C., Falgenhauer L., Ehrmann M, & Chakraborty T. (2023). A Single Residue within the MCR-1 Protein Confers Anticipatory Resilience. Microbiology Spectrum, 11(3), e03592-22.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Taste Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed qPCR using previously described methods^{58 (link)}. Tongue halves were stored in RNAlater (Fisher Scientific) at -80 °C until use. Primer sequences (Integrated DNA Technologies) are listed in Table 2. We performed qPCR using the QuantiTect SYBR Green PCR kit (Applied Biosystems) and the QuantStudio III Real-Time PCR Systems (Applied Biosystems). We normalized transcripts to gapdh1 and used the 2^–ΔΔCT method to analyze changes in mRNA expression in DSS-treated relative to water-treated tongues^{77 (link)}.Table 2

Primers.

Gene accession #		Sequence 5’-3’	Size (bp)
Tas1r1 (NM_031867.2)	Forward primer Reverse primer	TGGCAGCTATGGTGACTACG CAGCACCACAGACCTGAAGA	226
Tas1r2 (NM_031873.1)	Forward primer Reverse primer	GCACCAAGCAAATCGTCTATCC ATTGCTAATGTAGGTCAGCCTCGTC	212
Tas1r3 (NM_031872.2)	Forward primer Reverse primer	ACTACATACTGGGCGGGCTA GGTGAGAACCTGTTGCACGG	100
Krt8 (NM_031170.2)	Forward primer Reverse primer	TCTTCTGATGTCGTGTCCAAGTG GATCCTCGGACGGGTCTCTAG	130
Gapdh (NM_001289726.1)	Forward primer Reverse primer	GGAAGGGCTCATGACCACAG TCACGCCACAGCTTTCCAG	81

Dong G., Boothe K., He L., Shi Y, & McCluskey L.P. (2023). Altered peripheral taste function in a mouse model of inflammatory bowel disease. Scientific Reports, 13, 18895.

+ Open protocol

+ Expand

Quantifying CTLA-4 and Foxp3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from peripheral blood with TRIzol reagent (Takara, Dalian, China) followed by reverse transcription into complementary DNA (cDNA) according to the manufacturer’s instructions (Thermo Scientific, Waltham, MA, USA). Real-time quantitative polymerase chain reaction (PCR) was performed with QuantiTect SYBR Green PCR Kit (Applied Biosystems, Foster City, CA, USA) in ABI PRISM 7500 PCR instrument (Applied Biosystems) according to the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal reference. The primers were as follow: CTLA-4, 5′-TGCGGCAGACAAATGACCA-3′ and 5′-CAAAGTATGGCGGTGGGTA-3′; Foxp3, 5′-TTCTCAAGCACTGCCAAGC-3′ and 5′-GTCTCCGCACAGCAAACAA-3′; GAPDH, 5′-CTGAGTATGTCGTGGAGTCTAC-3′ and 5′-AGTCTTCTGAGTGGCAGTGATG-3′. The relative gene expression level was calculated by the 2^-ΔΔCt method.

Pan Y., Fang H., Lu F., Pan M., Chen F., Xiong P., Yao Y, & Huang H. (2017). Ulinastatin ameliorates tissue damage of severe acute pancreatitis through modulating regulatory T cells. Journal of Inflammation (London, England), 14, 7.

+ Open protocol

+ Expand

Semi-Quantitative and Quantitative RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Semiquantitative RT-PCR (Eppendorf Mastercycler, Eppendorf, Germany) was performed using the PCR Red-Mastermix 2x (Genaxxon Bioscience, Ulm, Germany). PCR products were separated using agarose gel electrophoresis and visualized after staining with GelRed (Genaxxon Bioscience). Images were captured using a Biometra (Göttingen, Germany) gel documentation station. Quantitative RT-PCR was performed using the MyiQ^TM system (Bio-Rad, München, Germany) in combination with the Quantitect SYBR Green PCR Kit (Applied Biosystems, Darmstadt, Germany). 1 μl of cDNA template was used in 25 μl reaction mixture. Results were analyzed using the Bio-Rad iQ5 Optical System Software and the comparative CT method. All data are expressed as 2^-ΔΔCT for the gene of interest normalized to the housekeeping gene Gapdh and presented as fold change relative to controls. The following primers have been used throughout this study: Arg1for 5′- AACACTCCCCTGACAACCAG-3′, Arg1rev 5′-CTGAAAGGAGCCCTGTCTTG-3′ [NM_007482.3], Igf1for 5′-CTGGACCAGAGACCCTTTGC-3′, Igf1rev 5′-GGACGGGGACTTCTGAGTCTT-3′ [NM_010512], IL4for 5′-ATTTTGAACGAGGTCACAGGAGAAG-3′, IL4rev 5′-ACCTTGGAAGCCCTACAGACGAG-3′ [NM_021283.2], Gapdhfor 5′-GGCATTGCTCTCAATGACAA-3′, Gapdhrev 5′-ATGTAGGCCATGAGGTCCAC-3′[NM_001289726].

Hühner L., Rilka J., Gilsbach R., Zhou X., Machado V, & Spittau B. (2017). Interleukin-4 Protects Dopaminergic Neurons In vitro but Is Dispensable for MPTP-Induced Neurodegeneration In vivo. Frontiers in Molecular Neuroscience, 10, 62.

+ Open protocol

+ Expand

RT-qPCR Analysis of FOXQ1 Expression in Breast Cancer Subtypes

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR was conducted according to the detailed protocol as previously described.40 (link) Total RNA was extracted from BC patients’ tumor samples and human breast normal tissue using the RNAqueous kit (Ambion, Streetsville, ON, Canada) according to the manufacturer’s instruction. cDNA was synthesised from 1 µg RNA using Superscript II reverse transcriptase.41 (link) RT-qPCR assays were performed with a QuantiTect SYBR Green PCR kit (Applied Biosystems Foster City, CA, United States) and analyzed on a LightCycler 96 Real-Time PCR System (Roche Life Science, Penzberg, Germany), at least three times with each reaction in triplicate. mRNA levels were normalized to TFRC (selected as an internal control gene) through the ΔΔCt method and changes in mRNA levels were described in fold change compared to the control samples. Primers for FOXQ1 and TFRC were designed using the Primer3 software (

http://primer3.ut.ee/

); FOXQ1: F: 5′-CGGAGATCAACGAGTACCTCA-3′, R: 5′-CAGTCGTTGAGCGAAAGGTT-3′; TFRC F: 5′-AACAACAGATTTCGGGAATGC-3′, R: 5′-CGTAGGGAGAGAGGAAGTGATA-3′. For statistical analyses, we first compared FOXQ1 expression in all four groups; normal breast tissue, TNBC, luminal, and HER2, using one-way ANOVA. Then, one-tailed unpaired Student’s t-tests and Bonferroni correction were used for multiple comparisons to assess statistical differences.

Elian F.A., Are U., Ghosh S., Nuin P., Footz T., McMullen T.P., Brindley D.N, & Walter M.A. (2021). FOXQ1 is Differentially Expressed Across Breast Cancer Subtypes with Low Expression Associated with Poor Overall Survival. Breast Cancer : Targets and Therapy, 13, 171-188.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Tumor Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tumor cells using TRIzol reagent (Invitrogen Corp., Carlsbad, CA). PCR was performed using the Step One Plus (Applied Biosystems, CA) and a QuantiTect SYBR Green PCR Kit (Applied Biosystems, Warrington, UK). The amplification program consisted of 1 cycle of 95°C with a 10 min hold (hot start), followed by 35 cycles of 95°C with a 20 sec hold, 60°C with a 20 sec hold, and 72°C with a 20 sec hold. After normalization with GAPDH, the median target level of implanted tumor only and non-irradiated bed were used as calibrators.

Lee E.J., Park H.J., Lee I.J., Kim W.W., Ha S.J., Suh Y.G, & Seong J. (2014). Inhibition of IL-17A Suppresses Enhanced-Tumor Growth in Low Dose Pre-Irradiated Tumor Beds. PLoS ONE, 9(9), e106423.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!