TRIzol reagent (Invitrogen) was used to extract the total RNA from clinical tissues or cultured cells following the instructions. PrimerScript RT Master Mix (Takara, Dalian, China) was applied for reverse transcription of 1 ug RNA into cDNA. Subsequently, SYBR Premix Ex Taq (Takara) was used for RT-qPCR on ABI 7500 (ABI, Foster City, CA, USA). GAPDH and U6 were internal parameters and the 2-△△Ct method was used to calculate the relative expression of genes. PCR primers are shown in Table 2
Primerscript rt master mix
Manufactured by Takara Bio
Sourced in Japan, China, United States
PrimerScript RT Master Mix is a ready-to-use solution for reverse transcription reactions. It contains PrimerScript Reverse Transcriptase, RNase Inhibitor, and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (35 mentions)
Trizol, by Thermo Fisher Scientific (13 mentions)
Sybr premix ex taq, by Takara Bio (10 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Tb green premix ex taq 2, by Takara Bio (6 mentions)
Tb green premix ex taq, by Takara Bio (5 mentions)
Du800, by Beckman Coulter (4 mentions)
Sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (4 mentions)
Rnaiso plus, by Takara Bio (4 mentions)
Sybr premix ex taq kit, by Takara Bio (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr select master mix, by Thermo Fisher Scientific (3 mentions)
Lightcycler 96, by Roche (3 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (2 mentions)
Sybr green realtime pcr master mix, by Toyobo (2 mentions)
Sybr green master mix, by Takara Bio (2 mentions)
Abi steponeplus system, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Takara Bio (2 mentions)
Abi 7500 system, by Thermo Fisher Scientific (2 mentions)
96 protocols using primerscript rt master mix
1
RNA Extraction and RT-qPCR Analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cells by using Trizol reagent (Invitrogen, Carlsbad, CA, United States), and qRT-PCR was performed by using the PrimerScript RT Master Mix (Takara Bio, Inc., Shiga, Japan) and TB Green Premix Ex Taq (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions. GAPDH was used as gene internal control and the final data were analyzed with the 2–ΔΔCt method. The specific sense primers for ITGAV, DAB2, SERPINE1, MATN3, PLOD2 and GAPDH are listed in Supplementary Table 1 .
3
Bovine Neutrophil Immunity Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fetal bovine serum (FBS), RPMI1640 medium, and PBS (Hyclon, Logen, UT); dairy cow peripheral blood neutrophil isolation kit (Hao Yang, Tian Jing, China); MH broth (Oxoid, Hampshire, UK); TLR2 receptor inhibitor (C29, MCE, China), TLR4 receptor inhibitor (TAK-242, MCE, China), NLRP3 receptor inhibitor (MCC950, MCE, China); COX-2 inhibitor (CAY10404), mPGES-1 inhibitor (MF63) (Cayman Chemical, MI, United States); gentamicin sulfate(Promega, Wisconsin, United States); Bovine IL-1β, IL-10, IL-8 ELISA Kits (Kingfisher, Biotech); Bovine IL-6 ELISA Kit (R&D Systems, California, United States); PGE2 ELISA Kit (Cayman Chemical, MI, United States); M-PER mammalian protein extraction reagent, Halt protease inhibitor, pre-stained protein ladders, blocking buffer, starting block T20 (TBS), LIVE/DEAD Bac Light Bacterial Viability Kits (Thermo Fisher Scientific); SDS-PAGE loading buffer (Takara, Shiga, Japan); Pierce BCA Protein Assay Kit (Rockford, United States); SDS-PAGE gel electrophoresis kit (Solarbio, Beijing, China); Axy Prep Multisource Total mRNA Miniprep Kit (Axygen Scientific, Union City, United States); Primer Script RT Master Mix (Takara); SYBR Green Master (Rox) (Roche, Basel, Switzerland). All primers were synthesized by Generay (Shanghai, China).
4
Quantitative PCR Analysis of GNG4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was extracted using an EZ‐10 DNAaway RNA Mini‐prep kit (Sangon Biotech Co., Ltd.). After the concentration and quality of RNA at 260/280 nm absorbance was determined, reverse transcription was performed by using PrimerScript RT Master mix (Takara Biotechnology Co., Ltd.). All of the PCR primers were obtained from Sangon Biotechnology. An ABI 7300 PCR system (Applied Biosystem) was used to perform the quantitative PCR reaction with SYBR Green Master Mix (Thermo Fisher Scientific). The primer sequences were as follows: GNG4 (forward primer, 5′‐GCATCTCCCAAGCCAGGAAAGC‐3′ and reverse primer, 5′‐ GCAGGCACTGGAATGATGAGAGG‐3′). Relative expression was normalized to GAPDH as an internal control and calculated using 2−△△CT.
5
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was first extracted from cells and tissue samples using TRIzol reagent (Invitrogen). Then, 1 μg RNA was reversely transcribed using PrimerScript RT master mix (Takara). Finally, qRT-PCR was carried out as previously reported.21 (link) All primer sequences for qRT-PCR were summarized in Table S1 .
6
Quantitative Gene Expression Analysis in Mouse Heart
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse heart tissues using FastPure Cell/Tissue Total RNA Isolation Kit (RC112-01; Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) according to the manufacturer's instructions. Total RNA was reversed into cDNA using PrimerScript RT Master Mix (RR036A; Takara Bio Inc., Shiga, Japan), followed by real-time qPCR using TB Green Premix Ex TaqII kit (RR820A; Takara Bio Inc., Shiga, Japan) with the CFX Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). GAPDH was used as a control, and a relative quantification method 2−ΔΔCT was used to quantify the relative expression of genes. Gene-specific primers for Real-time qPCR (Sangon Biotech, Shanghai, China) are listed in Table S3 .
7
Modulating NP Cell Activation via Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were activated with IL-1β (10 ng/mL) in presence or absence of inhibitors (CoPP, 10 μM; DPI, 10 μM; NAC, 10 mM) for 24 h. For experiments with application of CORM-3 (100 μM) or RuCl (100 μM), the treatment time duration was 16 h. RNA was extracted from human nucleus pulposus samples using Trizol (Invitrogen) according to the manufacturer’s instructions. The concentration of total RNA was measured at 260 nm with a spectrophotometer (DU-800; Beckman Coulter, Brea, CA, USA). First strand complementary DNA (cDNA) synthesis was performed with 500 ng of total RNA in a 10μLfinal volume containing 2 μL PrimerScript RT Master Mix (RR036A, Takara Bio Inc., Shiga, Japan) and 8μLof RNase-Free dH2O and total RNA. The reverse transcription procedure was carried out according to the manufacturer’s instructions.
8
Quantitative PCR Analysis of CD41+ Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CD41+ cells were sorted from the tails of Tg(CD41: EGFP) embryos including the CHT region at 5dpf as previously described [86 (link),87 (link)]. The total RNA was extracted from TRIzol (invitrogen) dissolved zebrafish whole embryos or the tails including CHT region or the sorted cells, and then transcribed into cDNA by PrimerScript RT Master Mix (TaKaRa). The quantitative PCR was carried out with SYBR Green Real-time PCR Master Mix (TOYOBO) with ABI 7900HT real-time PCR machine, and analyzed with Graphpad 5.1 software. The primers used were listed in S1 Table .
9
Quantifying TGEV-induced gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 12 h after incubation with TGEV at a multiplicity of infection (MOI) of 0.1 in each well of 6-well plates, total RNA was extracted from the cells using RNAiso Plus reagent (Invitrogen, USA) and subsequently reverse transcribed to cDNA (4 ng) using PrimerScript™ RT Master Mix (Takara, Japan). The β-actin and UBXN1 genes were subjected to quantitative real-time PCR using gene-specific primers (Table 2 ). The cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 55 °C for 30 s. A negative control was included in each run, and the specificity of the amplification reaction was tested by melting curve (Tm value) analysis. The relative expression levels of the three genes were compared using the 2−∆∆Ct method [15 (link)].
| Gene | Accession number | Sequence (5′–3′) | Size (bp) | Concentration |
|---|---|---|---|---|
| β-Actin | XM_003124280.2 | F: CTCTTCCAGCCCTCCTTCC | 97 | 0.5 µM |
| R: GGTCCTTGCGGATGTCG | ||||
| UBXN1 | XM_003353824.1 | F: TTGGAGCTTGTGGCCCAGAA | 139 | |
| R: GGCGCATTTCGTCTTCCTGG | ||||
| TGEV-N | NC_038861.1 | F: TTCAACCCCATAACCCTCCAACAA | 136 | |
| R: GGCCCTTCACCATGCGATAGC |
10
Quantification of lncRNA TUG1 and miR-29c-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of HK-2 cells was extracted using Trizol reagent followed by reverse-transcribed into cDNA using PrimerScript™ RT Master Mix (Takara, Shiga, Japan). Real-time PCR reaction was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems, USA). The relative mRNA expression of TUG1 genes were calculated using 2-ΔΔCt method. lncRNA TUG1 or miR-29c-3plevel was normalized to U6, the expression of mRNA was normalized to GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!