Total RNA of MC3T3-E1 cells was extracted on day 14 using the Trizol method (Sigma-Aldrich, MO, USA), and cDNAs were synthesized using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The RT-PCR system included 2.5 μL in cDNA, 1 μL of primer pair, and TransStart™ SYBR Green qPCR Supermix (TransGen Biotech, Beijing, China). The PCR cycle was set as 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec, with a final step at 72°C for 10 min. The miR-155 primers and the internal reference U6 were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The primers for SMAD5, ALP, and GAPDH were synthesized by Sangon Biotech, Shanghai, China. The primer sequences were as follows: SMAD5-F, CCAGCCGTGAAGCGATTG and SMAD5-F, GCCTTTTCTGCCCATTTCTCT; ALP-F, 5′-GAGCAGGAACAGAAGTTTGC-3′ and ALP-R, 5′-GTTGCAGGGTCTGGAGAGTA-3′; GAPDH-F, 5′-AACTCCCATTCCTCCACCTT-3′ and GAPDH-R, 5′-GAGGGCCTCTCTCTTGCTCT-3′. The expressions were calculated by 2−ΔΔCT method using GAPDH expression level as internal control.
Transstart sybr green qpcr supermix
Manufactured by Transgene
Sourced in China, United States
TransStart™ SYBR Green qPCR Supermix is a ready-to-use reaction mix for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, thermostable DNA polymerase, dNTPs, and necessary buffers and salts for efficient amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Easyscript first strand cdna synthesis supermix, by Transgene (6 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (3 mentions)
Trizol, by Merck Group (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Superquickrt cdna kit, by CWBIO (1 mentions)
Mircute mirna qpcr detection kit sybr green, by Tiangen Biotech (1 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (1 mentions)
Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Random primers, by Vazyme (1 mentions)
Rneasy kit mini kit, by Qiagen (1 mentions)
Abi 7600 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Plko 1 vector, by Merck Group (1 mentions)
17 protocols using transstart sybr green qpcr supermix
1
Quantifying miR-155 and Osteogenic Markers
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained using TRIzol reagent, and reverse transcription was performed to obtain cDNA. TransStart SYBR Green qPCR Supermix (TransGen Biotech) was used for PCR amplification using an ABI 7500 system, and the reaction systems were configured according to the manufacturer's instructions. Three replicate wells were employed, and the test was conducted three times. U6 and GAPDH were used as internal references for miRNAs and mRNAs, respectively, with 2‐△△qct for data analysis.23 The PCR primer sequences are listed in Table 1 .
3
miRNA and mRNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (including miRNA) was extracted from the cells using a miRcute miRNA Isolation Kit (DP501, Tiangen Biotech, Beijing, People’s Republic of China). The cDNA, for miRNA detection, was synthesized from 2 μg of total RNA using a miRcute miRNA First-Strand cDNA Synthesis Kit (KR201, Tiangen Biotech), and the cDNA, for target gene detection, was synthesized from 2 μg of total RNA using a SuperQuickRT cDNA Kit (CW2381, CWBIO). The relative miRNA expression was quantified by a SYBR Green miRcute miRNA qPCR Detection Kit (FP401, Tiangen Biotech) and was normalized according to hsa-U6 expression, and the relative target mRNA expression was quantified by a TransStart SYBR Green qPCR SuperMix (AQ131, TransGen Biotech, Beijing, People’s Republic of China) and was normalized according to the GAPDH expression. The forward primers for the miRNAs (Table 1 ), a universal reverse primer, and hsa-U6 primers were purchased from TransGen Biotech. The primers for the target gene mRNAs (Table 2 ) were synthesized by Sangon Biotech, Shanghai, People’s Republic of China. The PCR conditions for both detections were 95°C for 20 s and 60°C for 34 s. The relative levels of the miRNAs and the target mRNAs were defined from the threshold cycle (Ct) values calculated by the 2sΔΔCt method.
4
Quantification of IL-6 and IL-8 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was exacted from B2B cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesised using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) and used as a template. PCR was performed using TransStart SYBR Green qPCR SuperMix (TransGen Biotech) on a 7300 PCR system (ABI, Carlsbad, CA, USA). Commercial primers for IL-6 and IL-8, and the internal reference U6, were purchased from Guangzhou RiboBio (Guangzhou, China). Sequences of primers were 5′-GTAGCCGCCCCACACAGA-3′ (forward) and 5′-CATGTCTCCTTTCTCAGGGCTG-3′ (reverse) for IL-6 (101 bp); 5′-ATAAAGACATACTCCAAACCTTTCCAC-3′ (forward) and 5′-AAGCTTTACAATAATTTCTGTGTTGGC-3′ (reverse) for IL-8 (102 bp). Relative mRNA expression levels were calculated using the 2−ΔΔCt method [13 (link)].
5
Quantifying SARS-CoV-2 RNA in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SYBR Green I real-time PCR assay was used to detect the viral load in tissue samples. E gene as a target gene and mouse β-actin gene as a reference gene were detected in different tissues to analyze the viral RNA expression. Two pairs of primers were designed using the primer 5.0 software according to the gene sequences in GenBank (E gene, accession number KJ740747.1; β-actin, accession number NM_007393.4). The primers of E gene were as follows, E-F:5′-CGCTGAG ATGGAGGATTATGG-3′ and E-R:5′-ACTGATTGTTTGGTGGCGTG-3′. The primers of β-actin gene were as follows, β-F:5′-TGACAGGATGCAGAAGGAGA-3′ and β-R:5′- GCTGGAAGGTGGACAGTGAG -3′. The 25 μL PCR system contained 12.5 μL of 2 × TransStart SYBR Green qPCR SuperMix (TransGen, Beijing, China), 2 μL of cDNA template, 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), and 9.5 μLsterilized double-distilled water. The PCR thermal cycles were 95°C for 7 min, followed by 40 cycles of 94°C for 15 s and 59°C for 40 s, and collected fluorescence for 40 s at 59°C. Each sample was performed in triplicate.
6
Quantifying miR-21 and SOX2 Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-21 and SOX2 mRNA expression was detected by PCR according to a previously described method (Liu et al., 2013b). Briefly, total RNA was extracted using the Trizol method (Sigma-Aldrich, St. Louis, MO, USA) and cDNA synthesis was performed using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). cDNA (2.5 μL), 1 μL miR-21 specific primer (RiboBio, Guangzhou, Guangdong Province, China) or SOX2 mRNA primer, S100 and glial fibrillary acidic protein mRNA primer were mixed with TransStart™ SYBR Green qPCR Supermix (TransGen Biotech) and quantitative RT-PCR was performed to detect miR-21 and SOX2 mRNA expression. The green fluorescence intensity of PCR product SYBR was detected using a PCR instrument (ABI, Grand Island, NY, USA). U6 was used as an internal control of miR-21 and GAPDH mRNA as an internal control of SOX2, S100 and glial fibrillary acidic protein mRNA.
7
Quantitative RT-PCR Analysis of miR-144-5p and ATF2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was exacted using TRIzol (Invitrogen, Carlsbad, CA, USA) and used for cDNA synthesis with EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). Quantitative real-time PCR was performed in triplicate using the TransStart™ SYBR Green qPCR Supermix (TransGen Biotech) on a 7300 PCR System (ABI, Carlsbad, CA, USA). The primers for miR-144-5p and the internal reference U6 were purchased from RiboBio Co. The primer sequences for ATF2 and the internal reference GAPDH were as follows:
ATF2-F, 5′-CAATCCACTGCCATGGCCTT-3′; ATF2-R, 5′-TCAGATAAAGCCAAGTCGAATCTGG-C-3′; GAPDH-F, 5′-CGGAGTCAACGGATTTGGTCG-3′; and GAPDH-R, 5′-AGCCTTCTACATGGTGGTGAAGAC-3′. The relative RNA levels were calculated using the 2−ΔΔCt method.
ATF2-F, 5′-CAATCCACTGCCATGGCCTT-3′; ATF2-R, 5′-TCAGATAAAGCCAAGTCGAATCTGG-C-3′; GAPDH-F, 5′-CGGAGTCAACGGATTTGGTCG-3′; and GAPDH-R, 5′-AGCCTTCTACATGGTGGTGAAGAC-3′. The relative RNA levels were calculated using the 2−ΔΔCt method.
8
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the manufacturer’s instructions, total RNA was extracted by the RNeasy kit Mini Kit (Qiagen, Dusseldorf, Germany). Briefly, 2μg RNA was transformed into cDNA by reverse transcription reaction with random primers (Vazyme, Nanjing, China). The qPCR was performed on cDNA using TransStart® SYBR Green qPCR SuperMix (TransGen, Beijing, China) on a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). The primers were listed as follows: BASP1 forward: 5’-GCCCAGGAGACCAAAAGTGA-3’, BASP1 reverse: 5’-CCTTGGGTGTGGAACTAGGC-3’; GAPDH forward: 5’-CTCCTCCTGTTCGACAGTCAGC-3’, GAPDH reverse: 5’-CCCAATACGACCAAATCCGTT-3’. GAPDH was used as the endogenous control. The ΔΔCt was used to calculate the relative mRNA expression.
9
Quantitative Analysis of ATF2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and used as a template for cDNA synthesis using the EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). qRT-PCR was performed using the TransStart™ SYBR Green qPCR Supermix (TransGen Biotech) on a 7300 PCR System (ABI, Carlsbad, USA). The primers for ATF2 mRNA was purchased from RiboBio. The relative expression levels of mRNA were calculated through 2-ΔΔCt method. The primer sequences were as the follows: ATF2: F: 5′- CCGGATCCATGAAATTCAAGTTACATGT-3′, R: 5′-GGCTCGAGTCAACTTCCTGAGGGCTGTG-3′.
10
Quantitative Analysis of Inflammatory and Fibrotic Markers
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!