Pqcxih myc yap 5sa

Manufactured by Addgene

The PQCXIH-Myc-YAP-5SA is a plasmid designed for the overexpression of the Myc-tagged YAP-5SA protein. It contains the necessary elements for cloning and expression in mammalian cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Pqcxih myc yap, by Addgene (3 mentions) Pqcxih flag yap s127a, by Addgene (2 mentions) Pcdna3 icue3, by Addgene (2 mentions) Gfp pki nls, by Addgene (2 mentions) Pll3.7 ef eyfp yap1 wt polya, by Addgene (2 mentions) Pqcxih flag yap s381a, by Addgene (2 mentions) Pcw57, by Addgene (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

PQCXIH-Myc-YAP (7 citations) YAP 5SA (2 citations)

4 protocols using pqcxih myc yap 5sa

Plasmids from Addgene for YAP Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following plasmids were obtained from Addgene: pCW57.1 (Addgene plasmid, #41393); pcDNA3-ICUE3 (Addgene plasmid, # 61622) (DiPilato and Zhang, 2009 (link)). GFP-PKI nls (Addgene plasmid, #118301) (Billiard et al., 2001 (link)); pLL3.7-EF-EYFP-YAP1_WT-PolyA (Addgene plasmid, #112284) (Ege et al., 2018 (link)); pQCXIH-Myc-YAP (Addgene plasmid, #33091) (Zhao et al., 2007 (link)); pQCXIH-Myc-YAP-5SA (Addgene plasmid, #33093) (Zhao et al., 2007 (link)); pQCXIH-Flag-YAP-S127A (Addgene pasmid, # 33092) (Zhao et al., 2007 (link)); and pQCXIH-Flag-YAP-S381A (Addgene plasmid, #33068) (Zhao et al., 2010 (link)). Of note, YAP S381 in mice corresponds to residue S397 in humans; all reference to phosphorylation at this site was described as S397.

Drozdz M.M., Doane A.S., Alkallas R., Desman G., Bareja R., Reilly M., Bang J., Yusupova M., You J., Eraslan Z., Wang J.Z., Verma A., Aguirre K., Kane E., Watson I.R., Elemento O., Piskounova E., Merghoub T, & Zippin J.H. (2022). A nuclear cAMP microdomain suppresses tumor growth by Hippo pathway inactivation. Cell reports, 40(13), 111412.

+ Open protocol

+ Expand

Plasmids from Addgene for YAP Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

JMJD1a Silencing by siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNA transfections were performed using Lipofectamine RNAiMAX transfection reagent according to the manufacturer's instructions. Allstars negative control siRNA from Qiagen (siControl_1) and non-targeting siRNA from Dharmacon (siControl_2) were used as controls. Three independent siRNAs were used to silence JMJD1a: JMJD1a_1 custom siRNA (sense: 5′-GUCUAUGUGGGAAUUCCCA-3′, antisense: 5′-UGGGAAUUCCCACAUAGAC-3′) was ordered based on previous publication27 (link) from Sigma. Dharmacon JMJD1a siRNA (JMJD1a_2) was used to validate the results. Third siRNA (siJMJD1a_3; sense 5′-GCAAUUGGCUUGUGGUUACUU-3′ and antisense 5′-GUAACCACAAGCCAAUUGCUU-3′) was ordered based on previous publication57 (link) from Sigma. eGFP-JMJD1a (EX-T3698-M29) constructs were ordered from GeneCopoeia. pQCXIH-Myc-YAP (Addgene plasmid #33091) and pQCXIH-Myc-YAP-5SA (ref. 44 (link); Addgene plasmid #33093) were gifts from Kunliang Guan and constitutively active Src pLNCX chick src Y527F (Addgene plasmid # 13660) was a gift from Joan Brugge.

Kaukonen R., Mai A., Georgiadou M., Saari M., De Franceschi N., Betz T., Sihto H., Ventelä S., Elo L., Jokitalo E., Westermarck J., Kellokumpu-Lehtinen P.L., Joensuu H., Grenman R, & Ivaska J. (2016). Normal stroma suppresses cancer cell proliferation via mechanosensitive regulation of JMJD1a-mediated transcription. Nature Communications, 7, 12237.

+ Open protocol

+ Expand

Transfection of miR-21 Mimic and Inhibitor

Check if the same lab product or an alternative is used in the 5 most similar protocols

The oligonucleotide sequences of the miR21 mimic, inhibitor, or negative control (Table 3) were purchased from GenePharma (China). pQCXIH-Myc-YAP-5SA was a generous gift from Kunliang Guan (Addgene plasmid # 33093; http://www.addgene.org/33093/. RRID: Addgene_33093). The FLAG-LATS1^T1079A/S909A plasmid, PPP2R2B reporter plasmid, and PPP2R2B overexpression plasmid were synthesized by Hanbio Biotechnology (China). HTR8/SVneo cells at 70% confluency were transfected with 100 nM oligonucleotides or 1 μg of plasmids in the presence of Lipofectamine 2000 (Thermo Fisher Scientific, USA) in six-well plates according to the manufacturer’s instructions.Table 3

Sequences of mimic and inhibitor

Oligo	Forward 5′→ 3′	Reverse 5′ → 3′
hsa-miR21mimic	UAGCUUAUCAGACUGAUGUUGA	AACAUCAGUCUGAUAAGCUAUU
hsa-miR21 inhibitor	UCAACAUCAGUCUGAUAAGCUA
Negative control	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
inhibitor NC	CAGUACUUUUGUGUAGUACAA
mmu-agomir-NC	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
mmu-agomir-miR21	UAGCUUAUCAGACUGAUGUUG	AAACAUCAGUCUGAUAAGCUAU

Hu M., Zheng Y., Liao J., Wen L., Cheng J., Huang J., Huang B., Lin L., Long Y., Wu Y., Ye X., Fu Y., Qi H., Baker P.N, & Tong C. (2022). miR21 modulates the Hippo signaling pathway via interference with PP2A Bβ to inhibit trophoblast invasion and cause preeclampsia. Molecular Therapy. Nucleic Acids, 30, 143-161.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!