Total RNA of Day 10 nematodes treated as above was extracted using TransZol Up Kit (TransGen Biotech) and reverse‐transcribed with EasyScript® All‐in‐One First‐Strand cDNA Synthesis Kit (TransGen Biotech) according to the manufacturer's instructions. Quantitative real‐time PCR was carried out on a StepOnePlus Real‐Time PCR Instrument (Applied Biosystems) using PerfectStart® Green qPCR SuperMix Kit (TransGen Biotech) with act‐1 as a reference gene. All reactions were performed in three technical replicates from three biological repeats. The primers of gene transcripts used for the PCR analysis are listed in Table S9 .
Easyscript all in one first strand cdna synthesis kit
Manufactured by Transgene
Sourced in China
The EasyScript® All‐in‐One First‐Strand cDNA Synthesis Kit is a versatile laboratory product that enables the conversion of RNA to complementary DNA (cDNA) in a single-step reaction. The kit contains the necessary reagents and enzymes to perform this essential step in the RNA analysis workflow.
Automatically generated - may contain errors
Lab products found in correlation
Transzol up kit, by Transgene (1 mentions)
Perfectstart green qpcr supermix kit, by Transgene (1 mentions)
Steponeplus real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
Rnapure high purity total rna rapid extraction kit, by BioTeke (1 mentions)
Agilent mx3000p real time pcr system, by Agilent Technologies (1 mentions)
Lightcycle 480 system, by Roche (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
3 protocols using easyscript all in one first strand cdna synthesis kit
1
Nematode RNA Extraction and qPCR Analysis
2
Rapid RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells and tissues was extracted using RNApure High-purity Total RNA Rapid Extraction Kit (#RP1202, BioTeke Corporation, China) and then 1.0 μg RNA was reversely transcribed into cDNA using EasyScript All-in-One First-Strand cDNA Synthesis Kit (#AE341-03, TransGen Biotech, China). cDNA was amplified via real-time PCR using TransStart Tip Green qPCR SuperMix (#AQ141-04, TransGen Biotech, China) on the Agilent Mx3000P Real-Time PCR System (Agilent Technologies, USA). The primer details were provided in Additional file 1: Table S3.
3
HUVEC Total RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from different groups of HUVECs was extracted using Trizol reagent (Invitrogen, United States). The concentration of RNA was determined, and samples with purity (A260 / A280) between 1.8-2.1 were selected for the next step. The extracted total RNA was reverse transcribed into cDNA using the EasyScript® All-in-One First-Strand cDNA synthesis kit (Transgen Biotech, China). The expression of the target gene was relatively quanti ed by SYBR RT-PCR in Lightcycle 480 system (Roche, United States).
PCR conditions was 95 o C for 10 min, 40 cycles of 95 o C for 20 s, and nally 55 o C for 30 s. The relative mRNA levels was obtained by the 2 -ΔΔCT method using GAPDH as an internal reference gene. Primer design and synthesis were supported by Sangong Biotech (Shanghai, China). The primers sequences are as follows. PTEN forward: GTTGATGTTTATTTTTTTTAAGTGG and reverse: TATCAAATCTATTTACAACCCCAAT; PI3K forward: ATCGACCTACACTTGGGGGA and reverse: CAATATCTTCTGGCCGGGCT; AKT forward: TGGAGTGTGTGGACAGTGAAC and reverse: AGGTACAGATGATCCATGCGG.
PCR conditions was 95 o C for 10 min, 40 cycles of 95 o C for 20 s, and nally 55 o C for 30 s. The relative mRNA levels was obtained by the 2 -ΔΔCT method using GAPDH as an internal reference gene. Primer design and synthesis were supported by Sangong Biotech (Shanghai, China). The primers sequences are as follows. PTEN forward: GTTGATGTTTATTTTTTTTAAGTGG and reverse: TATCAAATCTATTTACAACCCCAAT; PI3K forward: ATCGACCTACACTTGGGGGA and reverse: CAATATCTTCTGGCCGGGCT; AKT forward: TGGAGTGTGTGGACAGTGAAC and reverse: AGGTACAGATGATCCATGCGG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!