Miscript pcr assay

Total RNA was isolated from the cells, quantified, and subjected to complementary DNA (cDNA) synthesis using miScript PCR assay (Qiagen, CA). Further, quantitative PCR was performed using miScript primer assay (Qiagen, CA) in Quant Studio 3 applied biosystem. The fold change in the expression of miR-4638-3p was calculated using ∆∆CT method. RPL13A/B was an endogenous control (Akshaya et al. 2022 (link)).
Fresh bones collected from respective groups were grounded into powder using liquid nitrogen, and total RNA was isolated. The cDNA was then synthesized using an iScript cDNA synthesis kit (Biorad, USA), and the qPCR analysis was performed with TB green premix Ex Taq II (Takara, USA) using the primers for Trap5 and Cathepsin K (Table 1). The relative expression of bone resorption marker genes (Trap5 and Cathepsin K) was estimated using the ∆∆CT method and normalized with RPL13A/B (Rohini et al. 2018 (link); Malavika et al. 2020 (link)).Table 1

List of primers used for bone resorption gens in qPCR analysis

SI. NO	Name	Primer (5′-3′)
1	m-TRAP5	F: CCAACCTGGCTTCTCTGACTTA
		R: AAGAGAGAAAGTCAAGGGAGTGGC
2	m-Cathepsin K	F:GCAGATGGGCAGATGTTTGTG
		R:ATACCTGGGAATGAACTGGTCG

Ascites (n = 8) and peritoneal fluid (n = 10) were thawed for 10 min at 37 °C and then placed on ice. Four hundred μL ascites and peritoneal fluid were centrifuged at 2000 x g for 10 min at 4 °C. Supernatant was applied to ExoComplete filterplate and centrifuged at 2000 x g for 5 min at 4 °C. Lysis buffer from miRNeasy (Qiagen), was applied to the wells in the filterplate. Total RNA was isolated per manufacturer’s protocol. Synthesis of cDNA was performed using miScript RT kit (Qiagen). The cDNA was diluted 1:4 and 1 μL was used with the miScript PCR assay (Qiagen) for qPCR screening. For miRNA analysis, Excel and DataAssist v3.01 was used with the following parameters: cut-off value of Ct = 36, SNORD61 selected as endogenous reference RNA.

A subset of miRNAs that were identified as differentially expressed with statistical significance (P < 0.05) were chosen for further investigation using a custom miScript PCR assay (Qiagen, USA). 3 reverse transcription controls (miRTC), 3 positive PCR controls (PPC), 6 housekeeping genes (SNORD95, SNORD68, SNORD96A, SNORD61, SNORD72, and RNU6-2), and 5 assay negative controls (miRNAs which were not detected (i.e., zero count) in the RNAseq reads) were included in the assay. Using total RNA as the starting material for cDNA synthesis, qRT-PCR was performed using this custom-formatted miScript SYBR Green PCR System. Quantitative RT-PCR of miRNA expression was performed in triplicates for each time point for each experiment, and the corresponding threshold cycle (C_t) values were collected. Three housekeeping genes with the lowest standard deviation were selected for normalization [26 (link)]. The threshold cycle (C_t) values from qPCR were analyzed using the RT² Profiler PCR Array data analysis tool (Qiagen) to calculate ΔΔC_t-based fold changes.