Oligo dt and m mlv reverse transcriptase

RNA extraction and RT-PCR analyses of cotton tissues were done using the method described by Wu and Liu (2004) . GhUBQ7 was used as the internal control. L6 Arabidopsis seedlings were germinated and grown on half-MS medium and were placed in liquid nitrogen at harvest. Total RNA was isolated from the collected tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific) and about 10 μg RNA of each sample was transcribed into cDNA. First-strand cDNA was obtained using OligodT and M-MLV reverse transcriptase (Promega, Madison, WI, USA). Q-PCR amplification was carried out on a Bio-Rad MyCycler thermal cycler with SYBER Premix ExTaq (TakaRa, Tokyo, Japan) according to the manufacturer’s instructions, and AtGAPDH was used as the internal control. The PCR thermal cycle conditions were as follows: one cycle of 95 °C for 2 min, followed by 45 cycles of 95 °C for 15 s, 58 °C for 15 s, and 72 °C for 25 s. The expression value of AtGAPDH was defined as 100, and the expression levels of genes were normalized accordingly. All of the primers used in these assays are listed in Supplementary Table S2, and the assays were carried out for three biological replicates. LSD tests (P<0.01) were used for multiple comparisons.

Total RNA was extracted from 5 ml of peripheral blood of 15 NSV patients and 15 CS, according to Chomczynski–Sacchi technique (Chomczynski & Sacchi, 1987). One microgram of total RNA was converted to cDNA using oligo‐dT and M‐MLV reverse transcriptase (Promega Corp., Madison, WI, USA).
MIF mRNA quantification was determined by quantitative real‐time PCR (qPCR) using UPL hydrolysis probes (Roche Applied Science, Germany) and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) used as a reference housekeeping gene (Cat. No. 05190541001). The PCR reaction was performed on a LightCycler Nano System (Roche Applied Science, Germany). All samples were run in triplicate using the conditions indicated in the UPL Gene Expression Assay protocol in a LightCycler Nano System (Roche Applied Science). After the validation of reaction efficiency, relative expression analysis was performed by the 2^−ΔCq and 2^−ΔΔCq methods.

Real‐time PCR was used to determine the expression of the CARNMT1 gene in human vastus lateralis having the EEF1A1 gene as a reference. Total RNA was isolated using Trizol® (Invitrogen) and chloroform and precipitated in isopropanol. RNA concentration and purity were measured in a micro‐spectrophotometer (NanoDrop ND2000, Thermo Scientific), with integrity being confirmed in denaturing agarose gel. cDNA was synthesized with oligo DT and M‐MLV reverse transcriptase (Promega). PCR was carried out with 20 ng cDNA, 22 μL SYBR™ Green (Applied Biosystems), and 300 nM of each primer in a final volume of 44 μL. The cycling conditions were 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 60 s, and a final 65–95°C melting ramp with 1°C increments. Signal intensity was monitored using the Rotor Gene‐Q HRM system (Qiagen). Primers sequences were as follows: CARNMT1: 5′‐TTCCGCTACTACGGCACC‐3′ and 5′‐TCCGGATCTTGTCCAAGTGA‐3; EEF1A1: 5′‐CTGGCAAGGTCACCAAGTCT‐3′ and 5′‐CCGTTCTTCCACCACTGAT‐3′.

PCR analyses were performed as described [19] (link), [33] (link). RNA from myotubes or muscle tissue was isolated with TRIzol (Invitrogen). cDNA was synthesized using random hexamers or oligo dT and M-MLV reverse transcriptase (Promega, Madison, WI). Target mRNA was amplified using an Eppendorf Mastercycler (Hauppauge, NY) or quantified using the ABI 7500 Real, Time PCR System (Applied Biosystems-Invitrogen). Isoform specific primers are listed in Table 1. Primer efficiency was assessed by amplifying a 10-fold dilution series of target cDNA and plotting Ct values verses log sample concentration. The slope of the standard curve was used to calculate efficiency [efficiency=(10^(−1/slope)−1)×100]. The abundance of target mRNA relative to rpl13A mRNA was determined using the comparative cycle threshold method [20] (link), [36] (link).

Total RNA was extracted immediately from 5 mL of EDTA—treated peripheral blood of RA patients and controls. Total leucocytes were isolated using 5% dextran solution (Sigma-Aldrich, St. Louis, MO, USA), and the RNA was obtained using TRIzol reagent (InvitrogenTM life technologies, CA, USA), according to the manufacturer’s instructions. The RNA was analyzed on a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA) by measuring the optical density (OD) at 260 nm for the quantity and the OD260/280 ratio for the quality. Before cDNA synthesis, RNA samples were treated with DNAse I (InvitrogenTM Life Technologies, CA, USA). 1 µg of total RNA was subjected to reverse transcription using oligo(dT) and M-MLV reverse transcriptase, as indicated by the manufacturer (Promega, Madison, WI, USA).

Total RNA was extracted from 5 mL of peripheral blood of 21 pSS patients and 20 CS (matched by age), according to the Chomcyznski and Sacchi technique [25 (link)], using TRIzoL reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. For mRNA analysis, 1000 ng of total RNA was retro-transcribed using oligo-dT and M-MLV reverse transcriptase as indicated by the manufacturer (Promega, Madison, WI, USA). The quantification of ICOS (TaqMan™ Gene Expression Assay, FAM; Assay IDs: Hs01057862_m1, Thermo Fisher Scientific, Waltham, MA, USA) mRNA was conducted by real-time PCR, using TaqMan Fast Advanced Master Mix (Applied Biosystems™, Waltham, MA, USA). The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference gene (TaqMan™ Gene Expression Assay, VIC; Assay IDs: Hs02786624_g1, Thermo Fisher Scientific, Waltham, MA, USA). All samples were run in duplicate using the conditions indicated in the Gene Expression Assay protocol in a QuantStudio 5 Real-Time PCR Systems (Termo Fisher Scientific, Waltham, MA, USA). The mRNA analysis expression was performed through 2^−ΔΔCt after validation of reaction efficiency to determine differences between the study groups.