pCFD3 (Addgene, #49410) was digested with BbsI (NEB, R0539). sgRNA oligos following phosphorylation were annealed by T4PNK (NEB, M0201) and inserted into a digested pCFD3 backbone by T4 DNA ligase (NEB, M0202).
Pcfd3
Manufactured by Addgene
The PCFD3 is a laboratory equipment product. It has a core function of performing a specific task, but no further details on its intended use can be provided in an unbiased and factual manner.
Automatically generated - may contain errors
Lab products found in correlation
T4 pnk, by New England Biolabs (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Phd dsred, by Addgene (1 mentions)
Ac5 stable2 neo, by Addgene (1 mentions)
Pcfd5, by Addgene (1 mentions)
Pc0046 ef1a pspcas13b nes hiv, by Addgene (1 mentions)
Pc0043 pspcas13b crrna backbone, by Addgene (1 mentions)
Pdsred attp, by Addgene (1 mentions)
Pc0040 lwacas13a crrna backbone, by Addgene (1 mentions)
Uas dssu, by Bloomington Drosophila Stock Center (1 mentions)
Pdsred attp vector, by Addgene (1 mentions)
Vas cas9, by Bloomington Drosophila Stock Center (1 mentions)
Pcfd3 du6 3grna, by Addgene (1 mentions)
10 protocols using pcfd3
1
Cloning sgRNA into pCFD3 Vector
2
Generating Myc-tagged Nephrin in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For generation of genomic Myc-nephrin, we targeted the second exon of sns using using pCFD3 (#49410; Addgene, target sequence: AGTGCCAGGTGGGACCGGCT ). A homology-directed repair template was assembled by a step-wise amplification of homologies upstream and downstream of the second exon of fly nephrin (sns) using a vector from the BACPAC library that covered the sns locus. A Myc sequence was inserted directly adjacent to the target’s (mutated) PAM. DsRed cDNA under P3 promoter flanked by loxP sites was derived from pHD-DsRed (Addgene plasmid #51434) and placed into the flanking intron that preceded the downstream homology. Twelve synonymous changes were introduced between Myc and the exon boundary to avoid alignment in the interjacent section. A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences (#54591; BDSC) by BestGene. CRISPR-edited lines were identified by the presence of DsRed eye fluorescence and the DsRed marker was removed by crossing to flies expressing cre recombinase (#1092; BDSC). We established the resulting Myc-nephrin flies as a homozygous stock.
3
Comprehensive Plasmid Database for Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For a list of plasmids, we generated for this study, see Additional file 3 : Table S2. The original plasmids we used for this project were obtained from Addgene: pCFD3 (#49410), pCFD5 (#73914), pACG:eCFP (#32597), pDsRed-attP (#51019), Ac5-Stable2-Neo (#32426), pC0056-LwaCas13a-msfGFP-NES (#105815), pC0040-LwaCas13a crRNA backbone (#103851), pC0046-EF1a-PspCas13b-NES-HIV (#103862), pC0043-PspCas13b crRNA backbone (#103854), pC0054-CMV-dPspCas13b-longlinker-ADAR2DD (E488Q/T375G) (103870), pXR001: EF1-CasRX-2A-eGFP (#109049), pXR004: CasRX pre-gRNA cloning backbone (#109054), pBID-UASc (#35200), [10 (link), 12 (link), 23 (link), 35 (link), 46 (link), 50 (link), 107 (link)–110 (link)]. We also obtained plasmids from the Drosophila Genetic Resource Center (DGRC): pAFW (#1111), pAHW (#1095), act-PhiC31-integrase (#1368). We also used plasmids we previously generated, enDmC, to generate some constructs for this study [8 (link)]. pMT-Gal4-puro plasmid was a kind gift from Christoph Metzendorf (University of Uppsala). All fragments used for the cloning step were amplified via PCR using Q5 high-fidelity DNA polymerase (NEB #M0491S) (Additional file 4 : Table S3) and fused together via Gibson assembly reaction [111 (link)].
4
Comprehensive Drosophila Genetic Toolkit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following Drosophila melanogaster lines were used: mlfΔC1, UAS-mlf [17 (link)], UAS-ds-mlf (National Institute of Genetics), UAS-lz, lzGAL4,UAS-mCD8-GFP, lzg, lzr1, N55e11, UAS-dsSu(H), P{EPgy2}DnaJ-1EY04359, UAS-dnaj-1, Def(3L)BSC884, vas-Cas9, UAS-GFPnls, NRE-GFP, GMR30C06, GMR30A01, UAS-dsSu(H) (Bloomington Drosophila Stock Center), Bc-GFP [70 (link)], Klu-mCherry [31 (link)] UAS-Bro-SMMHC [48 (link)], UAS-DnaJ-1ΔJ [61 (link)], UAS-dsSu(H), UAS-Su(H)-VP16 [46 (link)], UAS-Su(dx) [71 (link)]. To generate dnaj-1 deficient flies, we designed two guide RNA targeting dnaj-1 locus (S4 Fig ) and the corresponding DNA oligonucleotides (g2: GTCGACCACAACGCGCCGGATCAA; g3: GTCGCATCACAGTCACGCTTTCCT) were cloned in pCFD3 (Addgene). vas-cas9 females were crossed to P{EPgy2}DnaJ-1EY04359 males and the resulting embryos were injected using standard procedures with both pCFD3-g2 and pCFD3-g3 plasmids (500ng/ul). Deletion of the P{EPgy2}EY04359 transposon, as revealed by loss of the w+ marker, was screened for at the F2 generation, and deletion of dnaj-1 locus was assessed by PCR and sequencing.
All crosses were conducted at 25°C on standard food medium as described in [72 (link)].
All crosses were conducted at 25°C on standard food medium as described in [72 (link)].
5
CRISPR Genome Editing Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We identified optimal target gRNA sites by relying on comparable results from two independent programs, “CRISPR Optimal Target Finder” (University of Wisconsin; http://tools.flycrispr.molbio.wisc.edu/targetFinder/index.php ) and Harvard’s “Find CRISPR” sgRNA design tool (http://www.flyrnai.org/crispr/index.html )55 (link). Target sites were confirmed by sequencing corresponding loci in the Vas.Cas9 line (Bloomington #51323) that we used for embryo injections. CRISPR lines were generated via CRISPR/Cas9 homology-directed repair to replace endogenous alleles. Plasmids carrying gRNA target sites were cloned into pCFD3 (Addgene #49410) for AGBEFCF, AGBEFCM, IRP1A3F and IRP1B3F constructs, or pCFD556 (link),57 (link) (Addgene #73914) for IRP1AKO, IRP1AFCF and IRP1BKO. All donor template fragments were amplified from genomic DNA via PCR and cloned into the pDsRed-attP vector (Addgene #51019)57 (link). For primers see Table 3 .
6
CRISPR-Mediated Gene Disruption in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gRNA sequences were as follows: gish AATGGAGCCTATGAAGTCAA; CG7094-up ATATCTCGGACTAAGCATCA; CG7094-down ACGGGGTTGTGAGCCTCAGC. gRNA expression plasmids were created by ligation of annealed oligos into pCFD3 (Addgene 49410) (Port et al., 2014 (link)), diluted to 100 ng/μl and injected into nos-Cas9 Drosophila embryos (stock CFD-2; Fly Facility, Department of Genetics, University of Cambridge). Progeny of injected animals were screened for homozygous lethality (gish) or PCR screened to identify a deletion (CG7094; primers F1 tcgtgtgaacatcgtggtcgt and R2 ctttcggttggcagctttgtc). The gish17 mutation was genotyped using primers Gish_PCR_F1 GCGAATGTGTTGCTTTGGTG and Gish_M17_mut2 GTGTAGTTGCGGAGCCTTTC (318 bp amplicon was obtained specifically from mutant allele).
7
CRISPR Fly Design with PAM Site
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A conveniently located PAM site (TGG) was identified using CRISPR fly design. The guide RNA sequence chosen was—5′AGCCACTGCTGCCGGAGGAGTGG. The guide RNAs were cloned into plasmid pCFD3 (Addgene, Cat no: 49410). Silent modifications (AGC-AGT) were introduced into the seed sequence to prevent re-cutting and for subsequent molecular screening.
8
CRISPR-Mediated Generation of GFP-AID-Piwi Knock-In Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GFP-AID-Piwi knock-in flies were generated by CRISPR/Cas9 genome engineering. Homology arms of 1 kb flanking the targeting site were cloned into pUC19 by Gibson Assembly and co-injected with pCFD3 (Addgene # 49410) containing a single-guide RNA (Port et al., 2014 (link)) into embryos expressing vas-Cas9 (Bloomington Drosophila Stock Center # 51323). Flies expressing OsTIR1 under the D. melanogaster Ubiquitin-63E promoter were generated by phiC31 integrase-mediated transgenesis by injection of plasmids containing expression cassettes for proteins into embryos of genotype ‘y w P[y[+t7.7]=nos-phiC31\int.NLS]X #12; +; P[y[+t7.7]=CaryP]attP2,’ resulting in transgene integration on chromosome 3. Microinjection and fly stock generation was carried out by the University of Cambridge Department of Genetics Fly Facility. Transgenic and knock-in flies were identified by genotyping PCRs and confirmed via Sanger sequencing.
9
Simplified CRISPR Screening for PGRP-LE Δ231
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain PGRP-LEΔ231::GFP, co-CRISPR strategy (targets: PGRP-LE and ebony e) was used to simplify the screening process.63 (link) Guide RNAs (PGRP-LE: AGTGCTTCCACATTGAGTCG; ebony: CCACAATTGTCGATCGTCA) were cloned into pCFD3–dU6: 3 gRNA (Addgene, 49410).
The y1w1118 PGRP-LE::GFP; attP2{nos-Cas9 y+} embryos were microinjected with guide vectors (pCFD3–dU6:3 gRNA; Addgene # 49410; into which the guide RNAs were cloned) at 100 ng/μL pCFD3 PGRP-LE and 100 ng/μL pCFD3 ebony and the corresponding single strand donor oligonucleotide ssODN at 100 ng/μL. G0 flies were crossed to the double balancer stock def w+/FM6; Sb/TM3Ser, e. Each F1 fly with ebony body color (chrIII: nosCas9∗e/TM3Ser,e) was crossed to the balancer stock FM7/Sqh or Y. Then its gDNA was extracted. PCR and sequencing screenings were performed on each F1 ebony fly in order to identify the potential presence of a deletion of amino acid 231.
The y1w1118 PGRP-LE::GFP; attP2{nos-Cas9 y+} embryos were microinjected with guide vectors (pCFD3–dU6:3 gRNA; Addgene # 49410; into which the guide RNAs were cloned) at 100 ng/μL pCFD3 PGRP-LE and 100 ng/μL pCFD3 ebony and the corresponding single strand donor oligonucleotide ssODN at 100 ng/μL. G0 flies were crossed to the double balancer stock def w+/FM6; Sb/TM3Ser, e. Each F1 fly with ebony body color (chrIII: nosCas9∗e/TM3Ser,e) was crossed to the balancer stock FM7/Sqh or Y. Then its gDNA was extracted. PCR and sequencing screenings were performed on each F1 ebony fly in order to identify the potential presence of a deletion of amino acid 231.
10
CRISPR Fly Design with PAM Site
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A conveniently located PAM site (TGG) was identified using CRISPR fly design. The guide RNA sequence chosen was -5'AGCCACTGCTGCCGGAGGAGTGG. The guide RNAs were cloned into plasmid pCFD3 (Addgene, Cat no: 49410). Silent modifications (AGC-AGT) were introduced into the seed sequence to prevent re-cutting and for subsequent molecular screening.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!